(navigation image)
Home American Libraries | Canadian Libraries | Universal Library | Community Texts | Project Gutenberg | Children's Library | Biodiversity Heritage Library | Additional Collections
Search: Advanced Search
Anonymous User (login or join us)
Upload
See other formats

Full text of "RNA-protein interactions of a mitochondrial group I intron in Saccharomyces cerevisiae"

RNA-PROTEIN INTERACTIONS OF A MITOCHONDRIAL 
GROUP I INTRON IN Saccharomyces cerevisiae 



By 
HYMAVATHI K. TIRUPATI 



A. DISSERTATION PRESENTED TO THE GRADUATE SCHOOL 

OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT 

OF THE REQUIREMENTS FOR THE DEGREE OF 

DOCTOR OF PHILOSOPHY 

UNIVERSITY OF FLORIDA 

1998 



ACKNOWLEDGMENTS 

I thank Dr. Alfred S. Lewin, my mentor and supervisor, for his constant support 
in both academic and personal matters. He gave me immense freedom in the 
conduct of experiments and stood by me during difficult times. I knew 1 could 
always count on him. I would also like to thank all the past and present colleagues 
in the lab, who have made life in the lab enjoyable and friendly. 

I would like to thank the members of my advisor)' committee, Drs. Bert 
Flanegan, Henry Baker, and Phil Laipis, for the various constructive suggestions 
they have made during the course of the investigation and for taking the time to 
review various documents, including this one. I also appreciate the input from all 
the other faculty and students in the department, which has helped in my personal 
growth. I also thank the other personnel in the Department, especially Joyce 
Conners and Brad Moore, for their efficient help. 

My special thanks go to Chandu, my husband, who has stood by me during all 
times and made this all possible. 



11 



TABLE OF CONTENTS 

ACKNOWLEDGMENTS ii 

LIST OF TABLES v 

LIST OF FIGURES vi 

ABSTRACT vii 

CHAPTERS 

1 INTRODUCTION 1 

General Introduction 1 

Group I Introns 4 

Protein Facilitated Splicing 11 

Two-component System of Cbp2 and Intron 5 RNA 16 

Major Objective of Dissertation 19 

2 MATERIALS AND METHODS 21 

Over-expression and Purification of Cbp2 21 

In vitro Transcription 23 

UV-crosslinking and Generation of Peptides 23 

Site-directed Mutagenesis 27 

In vitro Splicing Assay 29 

Partial Proteolysis of Cbp2 30 

Equilibrium Binding Analysis 30 

3 IDENTIFICATION OF INTRON 5 RNA CONTACT SITES ON CBP2 
PROTEIN 32 

Introduction 32 

Results 35 

Discussion 46 

iii 



4 MUTATIONAL ANALYSIS OF THE N-TERMINUS OF CBP2 . . 55 

Introduction 55 

Results 58 

Discussion 100 

5 SUMMARY AND PERSPECTIVES 112 

LIST OF REFERENCES 130 

BIOGRAPHICAL SKETCH 149 



IV 



LIST OF TABLES 

2-1 Oligonucleotides used for mutagenesis of Cbp2 28 

4-1 Description of Cbp2 mutants 59 

4-2 Rate measurements for wild-type and mutant Cbp2 76 

4-3 Dissociation constants of Cbp2 mutants 81 



LIST OF FIGURES 

1-1 Proposed secondary structure of yeast apocytochrome b intron 5 RNA. 6 

3-1 Optimization of UV-dosage for crosslinking 37 

3-2 Chemical cleavage of Cbp2-intron 5 RNA complexes 40 

3-3 Confirmation of the crosslink site in the N-terminus of Cbp2 . ... 44 

3-4 Summary of UV-crosslinking results 47 

4- 1 Western analysis of Cbp2 mutants 61 

4-2 Functional analysis of deletion (aal7-aa28) and triple aromatic 

mutants 64 

4-3 Partial proteolytic profiles of deletion (aal 7-aa28) and triple aromatic 

mutants 66 

4-4 Time course of splicing for wild-type and mutant Cbp2 69 

4-5 Splicing rates of wild-type and mutant Cbp2 72 

4-6 Double filter-binding assay of wild-type and mutant Cbp2 77 

4-7 UV-crosslinking of wild- type and mutant Cbp2 to intron 5 RNA . . 83 

4-8 Effect of mutant proteins on wild-type Cbp2-mediated splicing . . .86 

4-9 Effect of increasing concentrations of wild-type Cbp2 on protein- 
mediated splicing 90 

4-10 Effect oftRNA addition on wild-type Cbp2-mediated splicing 93 

4- 1 1 Effect of mutant proteins on wild-type Cbp2-mediated splicing at 

low total protein to RNA ratios 97 



VI 



Abstract of Dissertation Presented to the Graduate School 

of the University of Florida in Partial Fulfillment of the 

Requirements for the Degree of Doctor of Philosophy 



RNA-PROTEIN INTERACTIONS OF A MITOCHONDRIAL 
GROUP I INTRON IN Saccharomyces cerevisiae 



By 

Hymavathi K. Tirupati 

December, 1998 

Chairperson: Alfred S. Lewin 

Major Department: Molecular Genetics and Microbiology 

Group I introns and associated proteins represent simple but valuable systems 
for understanding more complex RNP systems such as the spliceosomes or 
ribosomes, which employ multiple RNA-protein interactions. The terminal intron 
of yeast cytochrome b pre-mRNA (a group I intron) requires the nuclear protein 
Cbp2 for splicing in vivo. However, in vitro, this intron can be made to either self- 
splice or undergo protein-facilitated splicing by altering the Mg concentration. 
Since catalysis is intrinsic to RNA, the protein is believed to promote RNA folding 
at secondary and tertiary structure levels, leading to the formation of a catalytically 
competent intron. Therefore, this two-component system provides a model for 
understanding the role of proteins in promoting RNA folding. 

vii 



The present study was aimed at identifying critical RNA binding sites on Cbp2 
and gaining insights into Cbp2-intron 5 RNA interactions. P-labeled intron 5 
RNA was UV-crosslinked to Cbp2, and the crosslink sites identified by chemical 
cleavage and label transfer. These experiments demonstrated that the termini of 
Cbp2 contain important RNA binding sites. A 12-amino acid region (aal7-28) in 
the N-terminal contact site (rich in basic and aromatic residues) was targeted for 
mutagenesis, and mutant proteins characterized for RNA binding and stimulation 
of splicing . Mutations in this region resulted in no, partial, and complete loss of 
function, demonstrating the importance of this N-terminal region for stimulation of 
RNA splicing. These studies also led to the finding that Cbp2 stimulates splicing 
only in a narrow range of concentrations, with higher concentrations being 
inhibitory. Addition of a non-specific competitor tRNA attenuated this inhibition, 
demonstrating the non-specific RNA binding ability of Cbp2. 

The current study has identified an important RNA binding region (aal7-28aa) 
in the N-terminus of Cbp2. A tyrosine at position 21 is indispensable while three 
charged residues at positions 20, 22 and 24 are important for Cbp2 function. An 
offshoot of the current study is the identification of an RNA chaperone function 
for Cbp2. Cbp2 appears to engage in both non-specific and specific interactions 
with intron 5 RNA. At inhibitory concentrations of the protein, however, non- 
specific interactions may predominate and preclude the formation of specific 
contacts that promote catalysis. This newly characterized chaperone function of 
Cbp2 may be important for promoting correct intron 5 RNA folding in vivo. 



vin 



CHAPTER 1 
INTRODUCTION 



General Introduction 



Ribozymes, or catalytic RNA molecules, have been shown to catalyze reactions 
at phosphorus centers with RNA or DNA as the substrate (Cech, 1987; Herschlag 
and Cech, 1990; Robertson and Joyce, 1990; Forster and Altman, 1990). These 
reactions include transesterification or hydrolysis of phosphate diesters or 
phosphate monoesters. For instance, ribozymes have been shown to catalyze the 
polymerization of RNA monomer strands (Been and Cech, 1988), replication of 
RNA strands (Green and Szostak, 1 992), and hydrolysis at internal processing sites 
(Decatur et al, 1995; Einvik et al, 1997; Jabri et al., 1997). RNA catalysts can 
also act on substrates other than nucleic acids. In vitro selected RNA molecules 
have been shown to interact with amino acids such as arginine, phenylalanine, 
tryptophan and valine (Majerfeld and Yarus, 1994; Yarus, 1991; Zinnen and 
Yarus, 1995). Arginine-binding RNA motifs (Tan etal, 1993) and aromatic side 
chains (Valegard et al., 1994) have been found to be important for protein-RNA 
interactions. Although aliphatic-RNA interactions have been frequently neglected, 
their avidity and specificity seem sufficient for a biological role. Also, the 
guanosine binding site of group I introns has been shown to bind arginine, 

1 



suggesting that the proto-ribosome might be related to group I introns (Yarus, 
1991). 

RNA catalysis is not limited to ribozymes alone. It is also involved in two 
important steps of gene expression: mRNA processing and protein synthesis. In 
mRNA splicing, small nuclear RNAs recognize the reaction sites (Guthrie, 1991; 
Steitz, 1992) and may participate directly in the chemical steps (Madhani and 
Guthrie, 1992; McPheeters and Abel son, 1992), while the associated proteins may 
facilitate proper folding of these RNA molecules. It is also possible that, in 
addition to participating in mRNA splicing, RNAs can catalyze a variety of post- 
transcriptional RNA modifications. For instance, a calcium-metalloribozyme has 
been shown to efficiently catalyze a self-capping reaction with free GDP, yielding 
the same 5 '-capped structure as that formed by protein guanylyltransferase (Huang 
and Yarus, 1997a). This ribozyme was subsequently shown to possess self- 
decapping and pyrophosphatase activities (Huang and Yarus, 1997b), adding to the 
growing repertoire of the catalytic capabilities of RNA. 

The catalytic activities of RNA may also include facilitation of protein 
synthesis. Following extensive digestion of proteins from the prokaryotic 
ribosome, the large rRNA was shown to support the peptidyl transferase reaction, 
suggesting that RNA may be the catalytic component while ribosomal proteins 
may serve a scaffold function (Noller et ah, 1992). Recently, in vitro selected 
RNA molecules with a peptidyl transferase-like motif have been shown to bind a 



3 
puromycin analog (a high-affinity ligand of ribosomal peptidyl transferase), in the 

absence of protein (Welch et ai, 1997). Together, these results strengthen the 

hypothesis that peptidyl transfer originated in an RNA world. 

The catalytic role of RNA in translation of mRNAs appears to be versatile. A 
ribozyme derived from the group I intron of Tetrahymena thermophila was shown 
to catalyze the hydrolysis of an aminoacyl ester bond (which involves a carbon 
center), suggesting that the first aminoacyl tRNA synthetase could have been an 
RNA molecule (Piccirilli et ai, 1992). Furthermore, an RNA molecule identified 
by in vitro selection has been shown to rapidly aminoacylate its 2 '(3') terminus 
when provided with phenylalanyl-adenosine monophosphate (Illangasekare et ai, 
1995; 1997). Thus, RNA can accelerate the same aminoacyl group transfer 
catalyzed by protein aminoacyl-tRNA synthetases. 

The ongoing discovery of the versatile properties of catalytic RNA has lent 
more credence to the theories of a prehistoric "RNA world". This pre-biotic world 
might have been populated by life forms that stored genetic information in RNA 
and employed RNA catalysts prior to the advent of ribosomal protein synthesis 
(Visser, 1984; Benner et ai, 1989). It has also been proposed that the functions of 
these ancient catalytic RNAs may have been modulated by low molecular weight 
effectors related to antibiotics (Davies, 1990, Davies et ai, 1992). Antibiotics 
have been shown to inhibit translation by the prokaryotic ribosome (Moazed and 
Noller, 1987; Powers and Noller, 1994; Yamada et ai, 1978), either inhibit self- 
splicing (von Ahsen et ai, 1991; Davies et ai, 1992; von Ahsen and Noller, 1993) 



4 
or promote oligomerization (Wank and Schroeder, 1996) of group I introns, and 

inhibit the self-cleavage reaction of the human hepatitis delta virus ribozyme 
(Rogers et ai, 1996). Parallels between the inhibition of group I intron splicing 
and the protection of bacterial rRNAs by antibiotics also raises the possibility that 
group I intron splicing and tRNA selection by ribosomes involve similar RNA 
structural motifs. 

Group I Introns 
Group I introns are abundant in mitochondrial RNA of fungi and plants (Palmer 
and Logsdon, 1991). Coding regions for group I introns are also found in the 
nuclear genomes of other lower eukaryotes (rRNA genes of Tetrahymena), 
chloroplast DNAs, bacteriophages, and in several tRNA genes of eubacteria (Cech, 
1988; Michel and Westhof, 1990; Palmer and Logsdon, 1991; Reinhold-Hurek and 
Shub, 1992). Some of these group I introns can self-splice. The ability to self- 
splice is related to the highly conserved secondary and tertiary structures of these 
introns (Burke, 1988; Cech, 1988; Michel and Westhof, 1990). Although group I 
introns have relatively little sequence similarity, all share a series of short 
conserved elements designated P, Q, R and S. The secondary structure common to 
group I introns was first proposed by Michel et ah (1982) and Davies et al. (1982) 
based on comparative sequence analysis. This eventually led to the development 
of a three dimensional model of the catalytic core by Michel and Westhof (1990). 
The basic features of this model have been confirmed by mutational analysis, 
photochemical crosslinking and chemical modification studies employing several 



5 
affinity cleavage reagents (Pyle et al, 1992; Wang and Cech, 1992). On the basis 

of these studies, Cech et al. (1994) proposed a revised two-dimensional secondary 

structure for group I introns that represents more accurately the domain 

organization and orientation of helices within the intron, the coaxial stacking of 

certain helices, and the proximity of key nucleotides in three-dimensional space. 

Based on these revisions, the secondary structure of the fifth intron of the COB 

gene of Saccharomyces cerevisiae (used in the current study) is shown in Figure 1- 

1. The folded structure of group I introns consists of two co-axially stacked 

helices, P5-P4-P6 and P7-P3-P8, that form a cleft to enclose a third helical domain, 

P1P2, which contains the 5' splice site. The 5' and 3' splice sites are stabilized by 

PI and P10 interactions respectively. PI is formed by base pairing between the 5' 

exon and the internal guide sequence (IGS), whereas P10 is formed by base pairing 

between the 3' exon and the IGS (not shown in Figure 1-1). P9, a 2 base pair helix 

near P7 also contributes to the formation of 3' splice site. 

The rRNA intron of Tetrahymena thermophila (considered to be the prototype 

group I intron) has been demonstrated to undergo autocatalytic splicing by a two 

step trans-esterification mechanism (Cech, 1990). The same mechanism has been 

documented for a number of other group I introns (Garriga and Lambowitz, 1984; 

Garriga and Lambowitz, 1986). The first step comprises a nucleophilic attack by 

guanosine at the 5' splice site, resulting in a free 3' OH group on the upstream 

exon and guanosine addition to the intron. In the second step, the free 3' OH 

group on the exon attacks the phosphodiester bond at the 3' splice site, leading to 



Figure 1-1. Proposed secondary structure of yeast apocytochrome b intron 5 

RNA. The coaxially stacked helices, P4-P6 and P3-P7, along with the joining 
regions J3/4, J4/6, J6/7, and J8/7, constitute the catalytic core while P1-P2 forms 
the substrate domain. The peripheral element P7.1-P7.1a is a signature element of 
subgroup I A introns. Lower and upper case letters represent the exons and the 
intron respectively. Short horizontal and vertical lines represent hydrogen bonds. 
Dotted lines represent long-range interactions. Sequences for LI and L8 are not 
shown. 



L1 



P5 



a"" a a 

A U 

Va a 

A-U 

A-U 
U-A 
A-U 
C-G 

a u -°Aa 



Uf 



a c a c c a 





— A 

A 


200nt u 




A 




A 


A 


A 


A 


A 


A 


A 


A 


G 


A 


U 


u 


A 


U A U A G-C 


1 


U-A 


- 1 


u-G 


P1 


a-U 
u-A 


j c a u 


c-G 



220 



a c u u a u u a-3 ' 



710 

A AA U 

U u 
A A 

A-U 



P9.1 



+ 1 
738 



U-A 

C-G 

U-A 

U-A 

A-U 

U-A G A G-C 

G 

U 

u 



AA 
A G 

A-U 

U-A 
U-A 
A-U 
U-A 
U-A 



P9 



A 
A 
C 



U 



P4 



350 



*C-qAA 

u-a 305 

U-A 
G-C 
: U 
C-G 
A-U 



CA 
JJ 



P6 
L6 i 

P6a 



367 
L6a 



C-U 
C-G 

A G " C A 
GU-A A 
U-A 
U-A 
A-U 
U-A 
A-U 
U-A 
AC-G 



u 
M 



C-G A U U A 1 
A-U 
U-A 
P2 U-A 
A-U 
A-U 


1 / < 

I A 

:: C 
:: A 
: : G 


A-U 

440 u-G 

A j 

U-A 


: A 
: A 


' U-G 

C-G 
U-A 
U-A 
A-U. 

L2 i c 

■ rC 
A-U c 


; ; 
i : 
■ : 
: ; 



P6b 



P6c 



A" 
U 
A 



C U A 

u Cu-A 

A-U 
U-A 
A-U 
U-A 
U-A 
A-U 
U-A 
A-U 
A U-A 

U U-A 
A-U 
A-U 
U-A 
A-U 

A n-A A , 



P2a 
250 

L2a 



G-C 
U-A 
U-A 
U-G 
C-G 
C-G 
G-U 
C-G 

U U 
U 



U A 



AU AA 

400 



660 



A 

A 

G : 

U-A 

! C444 

C-G 

U-A P7 .,._ 

G-C 4 ? 6 

A " U U°A 

U-AGAAAG A 
I I I I I I 

ccuuuc u 

C A 
A A A 

C P7.1 U 

G 

A 

A 
U-A 
U-A 
G-C 
G-C 
U-A 
U-A 
A-U 
A-U 

■U-A 
U-A 
A-U 
A-U 
A-U 
U-A 
A-U 
U-A 



C U 
l > 
G A 



'A 
G 



L7.1a 



UA 

P7.1a 



P3 



P8 



500 



152nt 



L8 



8 
excision of the intron and ligation of the exons. An exogenous guanosine 

nucleotide is used as the nucleophile in the first step while a universally conserved 

3 '-terminal guanosine residue of the intron is employed in the second step (Cech, 

1990). These steps are chemically the reverse of each other, with the bound 

exogenous guanosine nucleophile in the first step equivalent to the 3' -terminal 

guanosine leaving group in the second step. This led to the proposal that a single 

guanosine-binding site was used in both steps (Inoue et al., 1986). Subsequent 

studies indicated that the rate constant of the chemical step is the same with 

exogenous guanosine bound to L-2 1 Seal ribozyme (a model system for first step of 

splicing) and with the intramolecular guanosine residue of the L-21G414 ribozyme 

(a model system for second step of splicing) (Mei and Herschlag, 1996). These 

results support the previously proposed single guanosine-binding site model, and 

further suggest that the orientation of the bound guanosine and the overall active 

site structure is the same in both steps of the splicing reaction. 

Oligonucleotide substrate binding to the Tetrahymena ribozyme was found to 

be stronger than predicted for a simple duplex interaction with the IGS, suggesting 

that tertiary interactions in addition to base pairing stabilized the bound substrate 

(Herschlag and Cech, 1990; Pyle et al, 1990). These tertiary interactions were 

shown to involve specific 2'-OH groups on the substrate and IGS, as well as the 

GU wobble pair at the 5' cleavage site (Pyle and Cech, 1991; Pyle et al, 1994; 

Strobel and Cech, 1993, Strobel and Cech, 1995). These and other kinetic studies 

led to a 2-step model for substrate binding, wherein the substrate forms a duplex 



9 
(PI) with the IGS to give an 'open complex', followed by docking of the PI 

duplex into tertiary interactions to give a closed complex (Herschlag, 1992). Thus, 

PI docking represents a tertiary-folding event in which a single duplex adopts its 

tertiary structure in the context of an otherwise fully folded ribozyme. PI docking 

was characterized further by isolating the open complex as a thermodynamically 

stable species using a site-specific modification and high Na + ion concentrations 

(Narlikar and Herschlag, 1996). These authors proposed that PI docking is 

entropically driven, and is possibly accompanied by a release of bound water 

molecules. 

It is interesting to note that group I introns do not contain specific functional 

groups that are typically employed in the catalysis of protein-enzymes. Instead, 

they depend on divalent cations for chemistry and certain other functions such as 

structural stabilization of folded RNA and substrate binding. For instance, the 

Tetrahymena group I intron requires Mg or Mn ions for catalysis (Grosshans 

and Cech, 1989), while cations like Ca 2+ can only promote RNA folding and 

substrate binding (Pyle et al, 1990). A two metal-ion mechanism has been 

proposed for group I introns and other catalytic RNAs (Steitz and Steitz, 1993). In 

this mechanism, one metal ion activates the 3' -OH of the guanosine factor which 

initiates the first step of group I intron splicing. The second one coordinates and 

stabilizes the oxyanion leaving group, that is, the 3'-OH of uridine created at the 

end of 5' exon which initiates the second step of group I intron splicing. These 

metal ions act as Lewis acids and stabilize the expected pentacovalent transition 



10 
states. In case of group I introns, the mirror symmetry of two Mg ions in the 

catalytic center reflects the identical chemistry of the two transesterification 

reactions that effect splicing. The role of RNA in catalysis is to position the two 

metal ions and properly orient the substrates. Evidence for the involvement of two 

Mg 2+ ions in the chemical step of group I intron splicing was provided by 

McConnell et al. (1997). The study also showed that a single Mg 2+ ion increases 

the rate of RNA substrate binding while one or more Mg 2+ ions reduce the rate of 

dissociation of substrate. Evidence for stabilization of the leaving group by a 

second Mg 2+ ion was subsequently provided by Weinstein et al. (1997). Studies on 

the crystal structure of the P4-P6 domain of Tetrahymena documented the first 

detailed view of metal-binding motifs in a structurally complex RNA (Cate et al, 

1996). Three unique metal binding sites have been found in the major groove, two 

of which are occupied by fully hydrated magnesium ions in the native RNA (Cate 

and Doudna, 1996). It is interesting to note that the tandem GU wobble base pairs, 

which comprise two of these three metal binding sites, are also abundant and 

conserved in the ribosomal RNAs. These sites, upon metal binding, might 

facilitate higher order folding of ribosomal RNAs or their association with 

ribosomal proteins. 

Group I introns have been classified into four major subgroups, IA through ID, 

based on distinctive structural and sequence features (Michel and Westhof, 1990). 

For example, group IA introns contain two extra base pairings, P7.1/P7.1a or 

P7.1/P7.2, between P3 and P7 while several other group IB and IC introns 



11 

including the Tetrahymena rRNA intron possess an extended RNA structure, 
P5abc, that is essential for catalysis (Joyce et al, 1989). Recent crystallographic 
studies revealed that P5abc stabilizes P4-P6, the major domain of the catalytic 
core, via two key interactions (Cate et al., 1996). The first one includes an 
adenosine-rich bulge which docks in the minor groove of the P4 helix while the 
second interaction takes place between a GAAA tetraloop and the minor groove of 
its conserved 1 1 -nucleotide receptor. In addition to base-specific hydrogen 
bonding and base stacking, pairs of interdigitated riboses (ribose zippers) further 
stabilize these long-range interactions in the P4-P6 domain. Other group I introns 
lacking P5abc possess additional RNA structures such as a long, peripheral 
extension of the P9 stem, denoted P9.1 (Wallweber et al, 1997) or protein factors 
(Mohr et al, 1994) that bind and stabilize the intron active structure. For example, 
the mitochondrial large ribosomal intron of N. crassa that lacks this extended 
domain absolutely requires a protein factor Cyt-18 for its activity, both in vitro and 
in vivo. The protein binds at the junction of P4-P6 stacked helices and facilitates 
correct geometry in this region (Saldanha et al, 1996). Cyt-18 could also replace 
the P5abc domain of Tetrahymena (Mohr et al, 1994). Thus an RNA-binding 
protein can provide substantial binding energy to stabilize the catalytic structure of 
the intron, obviating the requirement for an additional but important RNA element. 

Protein Facilitated Splicing 
Several mitochondrial transcripts in yeast employ protein factors to facilitate 
splicing of group I and group II introns, although some of them can self splice in 



12 
vitro. Protein-facilitated splicing has also been documented in other fungi such as 

Neurospora (Akins and Lambowitz, 1987; Saldanha et al., 1993) and Aspergillus 
(Ho et al, 1997). Some of these protein factors, termed maturases, are encoded 
within the intervening sequences (Carignani et al., 1983; Lamb et al., 1983; 
Lazowska et al, 1989). The reading frames encoding these maturases are in frame 
with the upstream exons. A proteolytic cleavage downstream of the 5' splice site 
generates the active form of maturase, presumably enabling a feedback mechanism 
of regulation. All yeast maturases (encoded by group I introns such as cob-12 and - 
13, and group II introns like coxl -11 and -12) primarily function in splicing the 
intron that encodes them. However, the cob-H maturase enables splicing of both 
cob-14 and another closely related group I intron, coxl -14 (Burke, 1988; 
Lambowitz and Perlman, 1990). 

The maturases encoded by group I introns are structurally related to site- 
specific endonucleases that confer mobility (Bell-Pedersen et al., 1990; Perlman 
and Butow, 1989). It is well established that group I introns can transpose site- 
specifically to intron-less alleles of the same gene after cleavage of the target DNA 
by an intron-encoded DNA endonuclease (Belfort and Perlman, 1995; Byrk and 
Mueller, 1996). This conservative process, known as intron homing (Dujon, 
1989), is highly specific because of the large recognition sites (15-35 bp) of 
homing endonucleases (Byrk and Mueller, 1996). Group I introns are thought to 
have become mobile following the acquisition of open reading frames (ORFs) that 
encode specific DNA endonucleases (Dujon, 1989; Lambowitz and Bellfort, 



13 
1993). Evidence for this came from the demonstration of autonomous mobility of 

an ORF, independent of the entire intronic sequence, in the mitochondria of 

Podospora anserina (Sellem and Belcour, 1997). The mitochondrial nadl-i4 

intron of Podospora contains one (monorfic) or two (biorfic) ORFs, according to 

the origin of the strain (Cummings et al, 1988; Sellem et al, 1996). The nadl-i4- 

orfl, recently acquired by the Podospora nadl-i4 intron (Sellem et al., 1996), 

appears to remain as a mobile entity, as it could be efficiently transferred from a 

biorfic intron to its monoorfic counterpart, independent of the core intron sequence 

(Sellem and Belcour, 1997). 

Reverse splicing coupled with reverse transcription and recombination may 
serve as an alternative mechanism for intron mobility (Cech, 1985; Sharp, 1985; 
Woodson and Cech, 1989). A related mechanism has been documented in the 
homing of group II introns of yeast mitochondria (e.g., aI2 intron of cox]) 
(Zimmerly et al., 1995; Yang et al, 1996) and Lactobacillus lactis (e.g., LtrB 
intron) (Matsuura et al, 1997). The insertion of these introns has been shown to 
occur by reverse transcription of unspliced precursor RNA at a break in double- 
strand DNA caused by an endonuclease activity. This DNA endonuclease activity 
is associated with RNP particles containing the excised intron RNA that cleaves 
the sense strand of the recipient DNA by reverse splicing and the intron-encoded 
reverse transcriptase protein that cleaves the anti-sense strand. 

Integration of an intron into foreign RNA (instead of DNA) by reverse splicing, 
followed by reverse transcription and recombination, could also lead to its 



14 
transposition. Reverse splicing into RNA has been demonstrated in vitro for group 

I introns such as Tetrahymena rRNA intron (Woodson and Cech, 1989) and the 

23 S rRNA intron from Chlamydomonas reinhardtii chloroplast (Thompson and 

Herrin, 1994). Recently, RNA-dependent integration of the Tetrahymena group I 

intron into the 23 S rRNA has been demonstrated in E. coli (Roman and Woodson, 

1998). The process of reverse splicing into RNA, unlike homing of group I and 

group II introns, does not require intron-encoded proteins. However, stable 

transposition into the genome would presumably require reverse transcriptase 

activity in the host (Belfort and Perlman, 1995). This activity could be provided 

by "indigenous" group II introns (Kennell et al., 1993) or retroelements present in 

many cell types (Eickbush, 1994). Importantly, reverse splicing appears to be 

significantly less sequence-specific than homing endonucleases and could 

therefore expand the repertoire of intron-containing sites (Cech, 1985; Roman and 

Woodson, 1998). 

In addition to maturases, several nuclear-encoded proteins essential for splicing 

of mitochondrial introns have been identified in yeast and Neurospora by 

screening cytochrome-deficient strains and by isolating nuclear suppressors of 

splicing mutants (Burke, 1988; Lambowitz and Perlman, 1990). In Neurospora, 

the products of three nuclear genes, cyt-18, cyt-19 and cyt-4 have been implicated 

in splicing the mitochondrial large rRNA intron and several other mitochondrial 

group I introns. In contrast, most of the yeast proteins facilitate splicing of a single 

intron. For instance, the product of MRS 1 in yeast appears to be specific to the 



15 



group I intron, cob-bB (Kreike et al, 1987, Kreike et al, 1986), although an 
intron-encoded maturase is also required for excision of this intron (Holl et al, 
1985). Proteins facilitating the splicing of group I introns may exhibit additional 
biological functions as documented in the case of certain aminoacyl-tRNA 
synthetases. The yeast NAM2 gene, for example, encodes mitochondrial leucyl- 
tRNA synthetase which also facilitates the splicing of group I introns, cob-U and 
cox-U (Labouesse et al, 1987; Herbert et al, 1988). Similarly, the Cyt-18 protein 
of Neurospora which is responsible for the splicing of several group I introns also 
happens to be the mitochondrial tyrosyl tRNA synthetase (Akins and Lambowitz, 
1987). These synthetases and other pre-existing RNA-binding proteins may have 
evolved to recognize sequences or structures in group I introns that resemble their 
normal cellular targets (Lambowitz and Perlman, 1990; Caprara et al, 1996). 

Nuclear-encoded proteins also appear to be important for group II intron 
splicing. Two genetically identified proteins that are likely to function directly in 
group II intron splicing are MRS2 and MSS1 16 (Wiesenberger et al, 1992; 
Seraphin et al, 1989). MRS2 functions in splicing of all four yeast group II 
introns (coxl-U, -12, -I5y and cob-U), and is relatively specific for these introns, 
while MS SI 16 is involved in splicing group II introns (coxl-U and cob-U) and 
also some group I introns. However, both MRS2 and MSS1 16 appear to have 
some additional function besides splicing, as gene disruptions result in a 
respiratory-deficient phenotype in yeast strains whose mtDNA contains no introns 
(Wiesenberger et al., 1992; Seraphin et al., 1989) 



16 
Two-Component System of Cbp2 and Intron 5 RNA 

The yeast cytochrome b gene contains five introns, of which the terminal intron 
is a group IA intron (bI5). In some yeast strains, the gene has only two introns, 
with the terminal intron designated bI2. The processing of this group I intron in 
vivo was demonstrated to be dependent on a protein factor designated Cbp2 
(McGraw and Tzagoloff, 1983). The nuclear gene encoding Cbp2 was identified 
by complementation of cytochrome b mutants (defective in the excision of the 
terminal intron) with a yeast genomic library. This analysis identified an 1 890 
nucleotide-long ORF encoding a basic protein of 74 kDa. Deletion analysis 
revealed that the entire ORF was essential for complementation of the cbp2 
mutants. Later, a mitochondrial revertant was shown to contain a precise deletion 
of the terminal intron of cytochrome b gene, demonstrating that neither Cbp2 nor 
the intron itself is required for growth on non-fermentable carbon sources (Hill et 
al, 1984). In addition to these findings, Cbp2 has been shown to be important in 
the splicing of the © intron of large ribosomal RNA (Shaw and Lewin, 1997). 

The terminal intron (intron 5) of cytochrome b can self-splice in vitro at high 
concentrations of Mg (Gampel and Tzagoloff, 1987; Partono and Lewin, 1988), 
whereas Cbp2 is essential to enable splicing at physiological concentrations of 
Mg 2+ (Gampel et al, 1989). Although this group I A intron possesses the 
conserved secondary and tertiary structures found in all group I introns, it varies in 
important ways from the prototype, the Tetrahymena rRNA intron. The fifth 
intron of cytochrome b is about 738 nucleotides long, making structural probing 



17 
harder compared to the rRNA intron of Tetrahymena (-400 nucleotides long). The 

internal guide sequence (IGS) that establishes the substrate specificity starts 220 

nucleotides downstream from the 5' splice junction, rather than the usual 14-20 

nucleotides described for other group I introns. The intron is AU-rich, requiring 

higher levels of Mg 2+ for stabilization of the active structure unlike the GC-rich 

Tetrahymena group I intron. It also possesses additional RNA structures like the 

P7.1 stem loop that are not found in Tetrahymena. Hence, intron 5 RNA, with its 

structural differences from the Tetrahymena rRNA intron, offers an opportunity to 

gain further insights into the mechanism of splicing of group IA introns. 

The fifth intron of COB pre-mRNA is also devoid of the peripheral RNA 

element, P5abc, that is important for the catalysis of Tetrahymena rRNA intron. It 

is therefore conceivable that Cbp2 compensates for this RNA structure and 

stabilizes its RNA partner by contributing substantial binding energy in a manner 

similar to the Cyt-18 protein of Neurospora. UV-crosslinking, chemical and 

enzymatic modification studies indicate that Cbp2 contacts intron 5 RNA at 

multiple sites in the catalytic core (P4) and peripheral RNA elements such as exon 

5, IGS, L2, L6 and stimulates the formation of the catalytically active structure 

(Shaw and Lewin, 1995; Weeks and Cech, 1995). Based on these and kinetic 

studies, Weeks and Cech (1996) proposed that Cbp2 serves as a tertiary structure 

capture protein. However, Cbp2 also induces the formation of RNA secondary 

structure, in addition to the stabilization of tertiary structure (Shaw and Lewin, 

1995; Shaw et al., 1996). In addition, chemical modification studies (Shaw and 



18 
Lewin, manuscript in preparation) show that Cbp2 binds to intron 5 RNA even in 
the absence of Mg 2+ and nucleates the formation of the catalytic core by stabilizing 
the P4/P6 domain. Thus, Cbp2 appears to be involved in a dynamic process of 
stabilizing RNA structure both at the secondary and tertiary structure levels, 
stimulating the formation of the catalytically active RNA structure. 

Weeks and Cech (1995a; 1995b) provided a kinetic framework for both Cbp2- 
mediated and self-splicing reactions of intron 5 RNA. At low Mg 2+ levels (5 mM), 
the self-splicing reaction is estimated to be 3 orders of magnitude slower than the 

9+ 

protein-facilitated reaction. At near saturating concentrations of Mg (40 mM), 
the protein-independent reaction is still 8-fold slower, indicating that high levels of 
the cation cannot completely compensate for Cbp2 function. The self-splicing 
reaction is always slower than the protein-facilitated reaction, since it has to 
proceed through two additional transitions compared to the latter. The first step 
involves a transition from secondary structure to an intermediate state that is 
efficiently promoted by Mg 2+ . However, self-splicing must still overcome a 
second barrier which is the transition from the intermediate to an active enzyme 
state that finally gives rise to products. The kinetics of Cbp2-mediated splicing, on 
the other hand, include two significant steps, namely, guanosine binding to the 
Cbp2-active intron 5 RNA complex followed by efficient conversion of this 
ternary complex to products. Studies on phosphorothioate substitution at the 5' 
splice site and pH profiles indicate that at physiological pH the self-splicing 
reaction is limited by chemistry while the Cbp2-facilitated reaction is limited by a 



19 
conformational step (Weeks and Cech, 1995a). These studies indicate that Cbp2 
binding compensates for at least two structural defects while increasing the rate of 

chemistry. 

Main Objective of Dissertation 

The availability of a two-component in vitro system to study autocatalytic and 
protein-facilitated splicing offers the advantage of studying RNA catalysis in 
isolation or in combination with the RNA-binding protein simply by varying the 
Mg 2+ concentration. Insights obtained from the analyses of this one protein-one 
RNA system will aid in understanding more complex systems like the 
spliceosomes involved in nuclear pre-mRNA splicing or ribosomes involved in 
protein synthesis, all of which employ multiple protein and RNA components. 

Studies so far have focused on mapping the Cbp2 contact sites on intron 5 RNA 
and the kinetics of splicing in the presence and absence of the protein. Little is 
known about the structure of Cbp2 protein or its interaction with intron 5 RNA 
from the protein point of view. In order to understand the role of Cbp2 in 
stimulation of splicing, it is important to determine the functional groups on the 
protein that intimately contact RNA and facilitate catalysis. Once the contact sites 
are identified, the actual mechanism of interaction between Cbp2 and intron 5 
RNA can be investigated further. Therefore, one of the main aims of the current 
project was to identify potential intron 5 RNA binding regions of Cbp2 using the 
technique of UV-crosslinking and label transfer. Following the identification of 
major contact sites, site-directed mutagenesis was employed to confirm the 



20 
importance of various amino acid residues in these sites for interaction with intron 

5 RNA and enable facilitation of splicing. 

UV-crosslinking identified two major RNA contact sites in the termini of Cbp2 
with the N-terminal site comprising the first 37 amino acid residues. The deletion 
of a potential RNA binding motif (aal7-SSSRYRYKFNME-aa28) in the N- 
terminal contact site abolished splicing activity, showing that this region was likely 
to be critical for Cbp2 function. Single and cluster mutagenesis of various 
residues in this region yielded a variety of mutants with no, partial, or complete 
loss of Cbp2 function. The characterization of these mutants and the significance 
of various amino acid residues in question are discussed in Chapter 4. 

An offshoot of the current study was the identification of an RNA chaperone 
function for Cbp2. The studies reported in Chapter 4 show that Cbp2 has a non- 
specific or generalized RNA binding capability besides its specific RNA binding 
component. Drawing parallels with studies on other RNA chaperones (Chapter 5), 
this study adds a new perspective on how the non-specific RNA binding activity of 
Cbp2 might play a critical role in the facilitation of intron 5 RNA splicing in vivo. 



CHAPTER 2 
MATERIALS AND METHODS 



Over-Expression and Purification of CBP2 

In vitro studies of CBP2-M5 RNA interactions were done with CBP2 protein 
purified to near homogeneity after over-expression in E. coli. Two versions of the 
protein, 6x histidine-tagged and native, were employed for different studies. 
Expression Clones 

His-tagged Cbp2. Plasmid pET15b-CBP2 was constructed by cloning the 
Ndel-Clal fragment carrying the CBP2 cDNA from pET3a-CBP2, downstream of 
the 6x histidine tag in the T7 expression vector, pET15b (Novagen). The histidine 
tag adds an additional 20 amino acid residues at the N-terminus of Cbp2 protein. 
The plasmid was transformed into JM109(DE3) strain of E. coli for over- 
expression. This strain carries the T7 RNA polymerase gene driven by lac-uv5 
promoter on a lambda lysogen and enables the induction of Cbp2 in the presence 
oflPTG. 

Native Cbp2. This form of Cbp2 protein was over-expressed from pET3a- 
CBP2 plasmid in BL21(DE3), another E.coli strain carrying the T7 RNA 
polymerase gene. This plasmid was constructed by introducing an Ndel site at the 
start codon of CBP2 gene by PCR-mutagenesis and cloning the Ndel-SnaBI 

21 



22 
fragment between the Ndel-BamHI sites of pET3a expression vector (Studier et 

al, 1990). The Cbp2 protein expressed from this construct is 20 amino acid 

residues shorter than the his-tagged version. 

Induction of Cbp2 

An overnight culture of bacteria carrying the Cbp2 expression plasmid was 

used to inoculate a large volume of LB/ampicillin medium at 1:100 dilution. The 

cultures were grown at 37° C until they reached an A550 of 0.35 and the expression 

of Cbp2 was induced with 0.4-1 mM IPTG for 1-3 hours. Cells were pelleted after 

addition of 17 u g/ml PMSF, washed with 20 mM Tris, pH 7.5, 50 mM NaCl, snap 

frozen in a dry ice/ethanol bath and stored at -70 C until purification. 

Purification of Cbp2 

His-tagged Cbp2. The protein was purified on Ni-NTA Superflow (Qiagen) 
column, adapting the protocol of Weeks and Cech (1995). This purification 
system is based on the high affinity of histidine residues for nickel ions 
immobilized on nitrilotriacetate resin. The contaminant proteins can be efficiently 
removed at low levels of imidazole (a competitor), while the his-tagged protein 
can be specifically eluted at slightly higher concentrations of imidazole. 

The bacterial pellet was resuspended in 10 ml of column buffer (50 mM 
HEPES, pH 7.6, 700 mM NaCl, ImM imidazole, 17.5 ug/ml PMSF) and lysed by 
two passages through a French pressure cell at 18000 p.s.i. The lysate was cleared 
by centrifugation at 35000 rpm for 30 minutes in a Beckman Ti 42.1 rotor. The 



23 
supernatant was loaded on a 2 ml Ni-NTA Superflow column pre-equilibrated with 

10 volumes of column buffer. The column was washed with 10 volumes of 

column buffer (ImM imidazole) followed by 7.5 volumes of wash buffer (20 mM 

imidazole). Cbp2 protein was then eluted with 7.5 volumes each of column 

buffers containing 80 mM and 200 mM imidazole. The fractions containing Cbp2 

(detected by SDS-polyacrylamide gel electrophoresis) were pooled and dialyzed 

twice against 1 liter each of 10 mM Tris, pH 7.5, ImM EDTA, 20% glycerol and 

once with a liter of 10 mM Tris, pH 7.5, ImM EDTA, 50% glycerol and stored at - 

70° C after rapid freezing in a dry ice/ethanol bath. 

Native Cbp2. This version of Cbp2 protein was isolated according to the 4- 
step purification protocol described by Shaw and Lewin (1995). 

In Vitro Transcription 

pSPI5 plasmid DNA purified by CsCl gradients (Maniatis et al, 1989) was 
linearized with Smal and used for in vitro transcription with T7 RNA polymerase 
(Partono and Lewin, 1988). The transcripts contain the entire intron 5 RNA 
sequence and the flanking exon sequences. The transcripts were internally labeled 
using a- 32 P UTP and/or a- 32 P ATP (ICN). 

UV-Crosslinking and Generation of Peptides 
UV-Crosslinking 

Cbp2-RNA complexes were generated according to the UV-crosslinking 
technique of Zamore and Green, 1989). P-labeled intron 5 RNA transcripts were 



24 
incubated at room temperature or 37° C for 30 minutes with a molar excess of his- 

tagged Cbp2 (7 fold over RNA) or native Cbp2 (21 fold) in a low salt buffer (50 
mM Tris, pH 7.5, 10 mM MgCl 2 , 50 mM NH 4 C1) containing excess tRNA (non- 
specific competitor). Each sample was split into several aliquots, 10 jj.1 each, in a 
96-well microtiter plate (Falcon) placed on ice (in a petridish) and exposed to 600 
mJ of UV radiation in a UV-Stratalinker (Stratagene). The aliquots of each sample 
were pooled into a 1.5 ml Eppendorf tube and treated with 0.32 ug/ml of RNAse A 
and 100 units of RNAse Tl (Boehringer Mannheim) at 37° C for 2 hours to remove 
uncrosslinked RNA. The samples were resolved by electrophoresis on a 10% 
SDS-polyacrylamide gel (Laemmli, 1970) and the band corresponding to Cbp2 
excised after Coommassie blue staining. The Cbp2 thus purified includes both the 
crosslinked and un-crosslinked forms of the protein. 
Generation of Peptides 

The purified gel fragments were incubated with chemical cleavage reagents 
such as hydroxylamine (NH2OH) and 2-nitro-5-thiocyanobenzoate (NTCB) and 
the resulting peptides were resolved on high percentage tris-tricine gels. 

Cleavage. The gel pieces were washed four times with distilled water over a 
period of 20 minutes, placed into appropriate cleavage buffer and thoroughly 
macerated with a Kontes Eppendorf pestle. The slurry so obtained was completely 
covered with the cleavage buffer and incubated overnight at appropriate 
temperature. 



25 
Chemical cleavage of proteins with hydroxylamine generates relatively large 

peptides due to the infrequency of Asn-Gly bonds. The asparaginyl side chain has 
a tendency to form a cyclic imide that is susceptible to nucleophilic attack by 
hydroxylamine (Bornstein, 1977). The cyclization is more favored in the context 
of a smaller amino acid like glycine resulting in increased susceptibility of Asn- 
Gly bonds. Hydroxylamine (NH 2 OH) cleavage of Cbp2 was performed by 
overnight incubation of Cbp2 containing gel pieces in 2.4 M guanidine-HCl, 2M 
hydroxylamine buffer, pH 9, at room temperature, as described above. LiOH was 
used to neutralize the guanidine-HCl and hydroxylamine-HCl due to increased 
solubility of LiCl compared to NaCl. The process of gel purification contributes to 
partial denaturation of the protein while the presence of guanidine-HCl, a strong 
solvent, enhances the exposure of the Asn-Gly bonds to the nucleophile. Chain 
cleavage occurs in the presence of alkaline hydroxylamine liberating a new amino- 
terminal amino acid. 

Cleavage with 2-nitro-5-thiocyanobenzoate (NTCB) is a two-step process. 
First, the thiol groups on cysteine residues of denatured proteins are modified to 
SCN groups by NTCB (Jacobson et al, 1973; Degani and Patchornik, 1974), 
followed by cleavage at the amino group of the modified cysteine by exposure to 
alkaline pH conditions. Gel purified Cbp2 protein was incubated in 2.4 M 
guanidine-HCl, 5 mM DTT, 1 mM EDTA, 0.2 M tris acetate, pH 8, buffer at 37° C 
for 2 hours in order to denature the protein and reduce the disulfide bonds to SH 
groups. A 10 fold excess of NTCB (50 mM) over the total thiol was added to the 



26 

gel slurry, and the incubation was continued for half hour at the same temperature 

to effect modification of the SH groups to SCN groups. The slurry was filtered 
through a 0.22 pM low protein-binding, cellulose acetate spin column (Corning- 
Costar), and washed once with distilled water. The slurry was later transferred to a 
1.5 ml Eppendorf tube and incubated overnight in 2.4 M guanidine-HCl, pH 9, 
cleavage buffer at 37 C . 

Extraction of peptides. After cleavage, the slurry was filtered through a 
Costar column, washed once with distilled water and incubated overnight at 37 C 
in the extraction buffer (0.1% SDS, 50 mM Tris pH 8.8, 0.1 mM EDTA and 0.2 M 
ammonium bicarbonate). On the third day, the gel slurry was heated at 85 C for 5 
minutes and rapidly filtered through a Costar column to recover soluble peptides. 
The slurry was further incubated with 0.5% SDS, 10 mM Tris, pH 8, for 20 
minutes at room temperature and filtered to extract the residual peptides in the gel. 

Acetone precipitation and electrophoresis. The filtrates containing the 
peptides were pooled, dried in a Speed- Vac (Savant), resuspended in water and 
precipitated overnight at -20° C with 9 volumes of acidified acetone. Peptides 
were pelleted at 12000 rpm in a microcentrifuge (Eppendorf) for 20 min and 
resuspended in 15 jj.1 of SDS gel-loading buffer. The samples were dried in a 
Speed- Vac to remove the residual acetone, brought to a final volume of 40 pi with 
water, resolved on 15% (for hydroxylamine ) or 16.5% (for NTCB) tris-tricine gels 
(Schagger and von Jagow, 1 987), along with C-labeled low molecular weight 
peptide markers (Amersham Corporation), and autoradiographed. 



27 



Site-Directed Mutagenesis 

The N-terminal RNA contact site on Cbp2 (identified by the UV-crosslinking 
strategy) was subjected to site-directed mutagenesis to identify key residues for 
Cbp2 function. Mutations were designed to either delete the region of interest 
(aal7 SSSRYRYKF aa25) or make point mutations that do not severely perturb 
the conformation of the protein. The Xbal-BamHl fragment encoding the first 97 
codons of CBP2 from pET15b-CBP2 was sub-cloned into the M13mpl9 vector 
and used as the template for oligonucleotide-directed mutagenesis. 
Mutagenesis Scheme 

Single stranded DNA isolated from the phage clone mentioned above was used 
as a template for mutagenesis. The oligonucleotides used for mutagenesis are 
shown in Table 2-1. The double primer method of Zoller and Smith (1984) was 
employed to introduce mutations into the CBP2 segment cloned into M13mpl9 
vector. Briefly, 10 pmoles each of the kinased mutagenic oligonucleotide and the 
universal Ml 3 primer were annealed to 0.5 pmoles of single-stranded DNA 
template by incubation at 65 C for 30 minutes, 37 C for 20 minutes and room 
temperature for 5 minutes. The annealed complexes were extended and ligated 
overnight at 15 C using 4 units of Klenow DNA polymerase (Promega) and 2.5 
units of T4 DNA ligase (BRL) to form a gapped heteroduplex. The reaction was 
diluted 200-fold, transformed into competent TGI cells (Amersham) and overlaid 



28 



Table 2-1. Oligonucleotides used for mutagenesis of CBP2 



Name 


Length 
(bases) 


Sequence (5' to 3') 


Description 


AL260 


19 


TAGCAAGCCCAATAGGAAC 


Universal primer (position 
1822-1804 in antisense 
strand of M13mpl9) 


AL261 


17 


TAAACGCTTGCTTACAG 


Sequencing primer to 
verify mutations (position 
790-774 in antisense 
strand of CBP2) 


AL262 


40 


TCTCCATGTTGAACAAATACA 
AGTAAAGAGAGGAACTGCC 


Changes RYRYKF to 
LYLYLF at aa 20,22,24 


AL263 


33 


CACCTGATGTGTGATATTGCCC 
TGTCTCCTCAA 


Deletion of aa 17-28 of 
Cbp2 


AL264 


42 


GATATTCTCCATGTTCAACTTC 
AACCTTAAACGAGAGGAACT 


Changes RYRYKF to 
RLRLKL at aa 21,23,25 


AL290 


30 


GTTGAACTTATACCTTAAACG 
AGAGGAACT 


Changes Y to L at aa 21 


AL291 


30 


CTCCATGTTGAACTTTAACCTG 
TAACGAGA 


Changes Y to L at aa 23 


AL 292* 


36 


GAACTTATACCTGTAACGACC 
CTGTCTCCTCAATGA 


Deletion of SSS at aa 
17,18,19 


AL293 


31 


GATATTCTCCATGTTCAACTTA 
TACCTGTAA 


Changes F to L at aa 25 



* AL292 also changes the codon usage for glycine at position 16 from GGC to 
GGU 



29 
with molten agar to allow formation of plaques. Mutants were identified by plaque 

lift hybridization with y- 32 P-labeled mutagenic oligonucleotide as the probe. The 

resulting mutants were plaque purified once and the single-stranded DNA 

sequenced. Double-stranded DNA was prepared by mini-prep protocols (Maniatis 

el al, 1989) from the mutant TGI clones. The CBP2 segment carrying the 

mutation of interest was then recloned into pET15b-CBP2 expression vector, and 

sequenced using Sequenase 2.0 kits (Amersham). 

In Vitw Splicing Assay 

The activity of various mutant Cbp2 proteins was determined by an in vitro 
splicing assay (Partono and Lewin, 1988). ' 2 P-labeled intron 5 RNA transcripts 
were incubated with wild-type or mutant Cbp2 proteins in 5 mM MgCb, 50 mM 
NH4CI, 50 mM tris-HCl, pH 7.5, buffer, in the presence of 5 mM DTT and 2 units 
of RNAsin RNase inhibitor (Promega), at 37° C for 10 minutes. Splicing was 
initiated with 0.2 mM GTP (Pharmacia) and the reactions allowed to continue for 
varying lengths of time. Reactions were terminated by the addition of equal 
volumes of 90% formamide, 25 mM EDTA or ethanol precipitated and 
resuspended in the formamide buffer. Reaction products were resolved on 4% 
polyacryiamide-8M urea gels and autoradiographed. 
Splicing Competition Assays 

These assays were done essentially as described above but in the presence of a 
constant amount of the wild-type protein and increasing concentrations of mutant 



30 
Cbp2 proteins. The deletion mutant lacking amino acids 17-28 and the triple 

aromatic mutant with Y 2 i, Y23 and F25 residues converted to leucine were 

employed to compete with the wild-type protein in splicing assays. As a control, 

the concentration of wild-type Cbp2 was increased to the same level of total Cbp2 

protein (wild-type + mutant) used in the above reactions but in the absence of 

mutant proteins. Spliced products were resolved on denaturing gels and 

quantitated using Phosphorlmager (Molecular Dynamics). 

Partial Proteolysis of Cbp2 

The conformation of mutant Cbp2 proteins was determined by comparing the 
partial proteolytic profiles of wild-type and mutant Cbp2. Partial proteolysis was 
done by incubating 0.5-1 ug of the wild-type (native or heat-denatured) or the 
mutant Cbp2 protein with trypsin, at protease:Cbp2 ratios of 1 :50 and 1 : 100 (w/w), 
for 1 hour at room temperature and the peptides resolved on 12% SDS-PAGE gels. 
The peptide profiles were detected by Western blotting performed according to 
Towbin et al. (1979), with a Cbp2-specific polyclonal antibody (a generous gift of 
Dr. Alexander Tzagaloff). 

Equilibrium Binding Analysis 

The affinity of wild-type and mutant Cbp2 proteins for bI5 RNA was 
determined by the double-filter binding assay (Wong and Lohman, 1993) with the 
exception that a charged nylon membrane (Hybond N + from Amersham) was used 
in place of DEAE. This method involves filtration of protein-RNA mixtures 
through a sandwich of two membranes, a nitrocellulose filter on top and a nylon 



31 
membrane at the bottom, in a 96-well dot-blot apparatus. The protein-RNA 

complexes are retained on the nitrocellulose while the free RNA is trapped by the 

nylon membrane. The fraction [RNA bound] can be calculated as follows: 

[RNA]bound = [RNAJtotai (Cnc - a C N y) / (C N c + C N y) 
where, Cnc and C N y correspond to the Phosphorlmager counts retained on the 
nitrocellulose and nylon filters respectively. The parameter a_refers to the RNA 
retained nonspecifically on nitrocellulose and is empirically derived from RNA 
bound in the absence of the protein (a = C N c / C N y at [protein] = 0). 

Protein-RNA complexes were generated by incubating a low concentration (16 
pM) of 32 P-labeled intron 5 RNA with increasing concentrations (0-4000 pM) of 
wild-type or mutant Cbp2 in 5 mM MgCl 2 , 5 mM DTT, 50 mM NH 4 C1, 50 mM 
tris-HCl, pH 7.5, buffer at 37° C for 30 minutes. The reactions exhibit equilibrium 
binding by 30 minutes. Duplicate reactions were filtered through a pre-soaked BA 
85 nitrocellulose membrane (Schleicher and Schuell) overlaid on a pre-wetted 
Hybond N + nylon membrane, in a 96-well dot-blot apparatus (Bio-Rad). The 
filters were washed four times with low salt buffer and the radioactivity retained 
on both the membranes was quantitated using a Phosphorlmager (Molecular 
Dynamics). The fraction [RNA bound] was calculated and K d of the mutants 
determined by the Cbp2 concentration needed for half maximal RNA binding. 



CHAPTER 3 
IDENTIFICATION OF INTRON 5 RNA CONTACT SITES ON CBP2 

PROTEIN 



Introduction 

Induction of crosslinks by ultraviolet light in nucleic acid-protein complexes 
has been a valuable tool for probing structural aspects of protein-DNA/RNA 
interactions. Ultraviolet (UV) photolysis provides a useful approach to determine 
the contact points between nucleic acid and protein, as it produces zero-length 
crosslinks in contrast to chemical crosslinking agents. The latter interpose spacers 
of varying lengths at the interface and hence are less appropriate to probe intimate 
contacts at the interface of protein-nucleic acid complexes. A free radical 
mechanism has been proposed to explain the process of UV-crosslinking of amino 
acids to nucleic acid bases (Shetlar, 1980). Photoexcitation of a nucleic acid base 
followed by abstraction of a hydrogen atom from a favorably positioned amino 
acid residue generates a purinyl or pyrimidinyl radical which recombines with the 
corresponding radical on the proximate amino acid residue. Such a zero-length 
recombination event requires an amino acid to be present in extremely close 
proximity to an excited base. Studies on the bacteriophage fd gene 5 protein, a 
single-stranded DNA-binding protein suggest that the amino acid and the base 

32 



33 
must also be present in a relatively specific topological arrangement to achieve 

photochemical crosslinking (Williams and Konigsberg, 1991). For instance, the 

amino acids Tyr-26 and Phe-73 of the bacteriophage fd gene 5 protein could not be 

crosslinked in a gene 5-ssDNA complex (Paradiso et ai, 1979; Paradiso and 

Konigsberg, 1982), although H nuclear magnetic resonance data suggest that 

these two residues form part of the DNA-binding domain of the protein (King and 

Coleman, 1988. The extent of photocrosslinking also depends on the intrinsic 

structure of the nucleic acid or protein. Among the nucleotides, thymine and 

uridine appear to be the most photoreactive, yielding greatest extent of 

crosslinking to proteins. On the other hand, in principle, any of the 20 amino acids 

found in proteins can be crosslinked to nucleic acids by UV-irradiation (Williams 

and Kongsberg, 1991). 

Photochemical crosslinking has been adapted to detect protein bound to specific 

32 

sites on double-stranded DNA using P-labeled, site-specific probes (Safer et ai, 

32 

1988). This method permits transfer of P from specific phosphodiester bonds to 
amino acid residues at the interface upon photocrosslinking (Williams and 
Konigsberg, 1991). We have employed a similar method to detect intron 5 RNA 
binding sites on Cbp2 protein. We synthesized intron 5 RNA transcripts 

32 

(internally labeled with a- P UTP), UV-crosslinked it to purified Cbp2 under 
conditions that favor specific complex formation, and detected the crosslinked 
Cbp2-RNA complexes on SDS-polyacrylamide gels by autoradiography as the 
protein became indirectly labeled upon photocrosslinking. 



34 
Various biochemical methods have been employed by several groups to identify 

the crosslinked peptides and amino acid residues at the interface of protein-nucleic 

acid complexes. The most common approach has been to digest the crosslinked 

complex with trypsin, rapidly isolate the peptides using anion-exchange HPLC, 

detect the peptides by their absorbance at 220 nm or 254 nm, and identify the 

crosslinked fragments by Cerenkov counting of the resultant fractions (Merrill et 

al, 1984; Merrill et al., 1988 and Shamoo et al, 1988). In case of proteins with 

known primary structure, the crosslinked amino acid residues have been identified 

by amino acid analysis following acid hydrolysis. For example, the crosslink site 

in the bacteriophage fd gene 5 protein was identified as cysteine-33 by this method 

(Paradiso et al, 1979). However, this may not represent a general approach as it 

depends on the ability of acid hydrolysis to regenerate the free amino acid from the 

crosslinked adduct. In most instances, the crosslinked amino acid was identified 

by amino acid sequencing, based on the following principle. A gas or liquid phase 

sequencer cannot extract the phenylthiazolinone derivative of the crosslinked 

amino acid from the polybrene-coated support disk and therefore leaves a hole in 

the sequence at the crosslinked position. Thus, the site of crosslinking is 

determined by the absence of an identifiable phenylthiohydantion derivative in the 

peptide sequence. Using this approach, the contact sites in E. coli SSB (Merrill et 

al, 1984) and Al hnRNP (Merrill et al, 1988) proteins crosslinked to 32 P-labeled 

(dT)g oligonucleotides were identified. In the case of E. coli SSB, the site of 

crosslinking was further confirmed by solid-phase sequencing which employed a 



35 
sufficiently polar solvent such as trifluoroacetic acid to extract the P-labeled 

phenylthiohydantion derivative of the crosslinked amino acid. 

In addition to the above biochemical methods, gel electrophoresis is a simple 
but powerful analytical technique to resolve complex mixtures of peptides and 
identify the indirectly labeled, crosslinked peptides by autoradiography. In the 
studies reported in this chapter, we have analyzed the UV-crosslinked, Cbp2- P 
labeled intron 5 RNA complexes by digesting the protein-RNA complexes with 
non-enzymatic cleavage agents and resolving the resultant peptides by one 
dimensional tris-tricine gel electrophoresis. We have mapped the major crosslink 
sites of intron 5 RNA to the N- and C-termini of Cbp2. 

Results 
Optimization of UV-Crosslinking Conditions 

One of the technical hurdles in biochemical characterization of crosslinked 
complexes is isolation of sufficient amounts of the protein-RNA complexes, 
relatively free from other species. As the yield of the product depends on the 
extent of crosslinking, reaction conditions must be optimized to maximize the 
crosslinking efficiency. To that end, the dosage of UV-radiation employed for 
crosslinking Cbp2 protein to intron 5 RNA was titrated, holding other conditions 
constant. P-labeled intron 5 transcripts were incubated with native Cbp2 under 
low salt conditions (5 mM MgCl 2 , 50 mM NH 4 C1) without GTP. Cbp2 binds to 
intron 5 RNA under these conditions and induces formation of the catalytic RNA 
conformation (Shaw and Lewin, 1995). The Cbp2-RNA complexes generated 



36 
were UV-crosslinked in the presence of excess tRNA (added as a non specific 

competitor) by the technique of Zamore and Green (1989), as described in 
Materials and Methods. The samples were irradiated at an increasing UV-dosage 
ranging from 100 to 950 mJ. As a control, intron 5 RNA was irradiated with a 
noncognate protein, BSA, at the highest UV-dosage (950 mJ) employed in the 
experiment. All samples were extensively treated with RNAse A and RNAse Tl 
to remove uncrosslinked RNA, and the protein-RNA complexes were resolved on 
SDS-polyacrylamide gels. The gel was autoradiographed (Figure 3-1) and also 
quantitated using Phosphorlmager. No crosslinked complex was observed in the 
presence of BSA (lane 1) even at a high dosage of UV-radiation, demonstrating 
the specificity of Cbp2-intron 5 RNA interaction. The extent of crosslinking of 
intron 5 RNA to Cbp2 increased by about 2-fold at a UV-dosage of 600 mJ (lane 
7) compared to that at lOOmJ (lane 2) and almost remained the same at higher 
doses (lanes 8 and 9). Thus a UV-dosage of 600 mJ was chosen as the lowest 
UV-dosage which yielded optimal complex formation. 
Identification of Cbp2 Peptides that Contact Intron 5 RNA 

The UV-crosslinking technique standardized above was successfully employed 
to identify the RNA contact sites on Cbp2 protein. 32 P-labeled intron 5 RNA 
transcripts were crosslinked to his-tagged Cbp2 under low salt conditions at a UV- 
dosage of 600 mJ as described above. The Cbp2-RNA complexes generated were 
purified on SDS-polyacrylamide gels. The gel fragments were then soaked in 
different chemical cleavage reagents like hydroxylamine (NH2OH) and 2-nitro-5- 



Figure 3-1. Optimization of UV-dosage for crosslinking. P -labeled intron 5 
RNA was incubated with Cbp2 or BSA under low salt conditions as described in 
Materials and Methods. Samples were irradiated with UV-doses ranging from 100 
to 950 mJ, extensively RNAase-treated, resolved on 10% SDS-polyacrylamide 
gels, and crosslinked complexes detected by autoradiography. UV-irradiation was 
done at 950 mJ for BSA (lane 1), and for Cbp2 at 100 mJ (lane 2), 200 mJ (lane 3), 
300 mJ (lane 4), 400 mJ (lane 5), 500 mJ (lane 6), 600 mJ (lane 7), 800 mJ (lane 
8), and 950 mJ (lane 9). 



38 



UV-dosage (mj) 

BSA 

Cbp2 



o o o 
in o o 

0\ l-H c^i 



+ 



+ + 



8 O Q 
OOO 
Tf ID v5 00 



o 
0> 




39 
thiocyanobenzoate (NTCB) to generate peptides. The peptides were separated on 

high percentage tris-tricine gels (Schagger and Von Jagow, 1987), and the 

crosslinked peptides that retained the label were identified by autoradiography 

(Figure 3-2). 

NH2OH cleaves proteins at asparaginyl-glycyl peptide bonds (Bornstein and 
Balian, 1977) and would yield three large peptides (15.1, 24, 37.1 kDa) in a 
complete digest of Cbp2. Cleavage of the crosslinked Cbp2-RNA complex 
(Figure 3-2, panel A) showed that the 24 kDa amino terminal and the 15.2 kDa 
carboxy terminal fragments of Cbp2 strongly crosslinked with intron 5 RNA, 
whereas the large central 37.1 kDa fragment displayed only a very weak signal. 
The fact that only two of the three peptides were strongly labeled suggests that the 
terminal fragments of Cbp2 might comprise important RNA binding domains. The 
weak signal retained by the central 37.1 kDa peptide suggests that other minor 
contact sites may be distributed throughout the length of protein. These sites of 
interaction may also contribute to the stabilization of the active intron structure, 
although the termini may be absolutely essential for the activity. 

NTCB is specific to amino groups of cysteines (Jacobson et al, 1973; Degani 
and Patchornik, 1974). NTCB Cleavage of Cbp2 would produce 9 peptides 
ranging from 0.17 to 29.5 kDa if the reaction proceeded to completion. However, 
for several reasons, only a partial digestion of the protein could be achieved. 
Incomplete cleavage results from (5-elimination and/or incomplete modification 
due to the reversible nature of the cyanylation reaction (Degani and Patchornik, 



Figure 3-2. Chemical cleavage of Cbp2-intron 5 RNA complexes. His-tagged 
Cbp2 was crosslinked to 32 P-labeled intron 5 RNA under low salt conditions in the 
absence of GTP, extensively RNAse treated, gel purified on 10% SDS- 
polyacrylamide gels, and digested in-gel with hydroxylamine (panel A) and NTCB 
(panel B). Following cleavage, peptides were extracted as described in Materials 
and Methods, separated on 15% (hydroxylamine) or 16.5% (NTCB) tris-tricine 
gels, dried and autoradiographed. Molecular weights of strongly crosslinked 
peptides are indicated by arrows, with asterisks representing partial cleavage 
products. Panel C. 0.2 mM GTP was added to the crosslinking reaction mixture 
and incubated at 37°C for 30 minutes. The reaction products were ethanol 
precipitated, resolved on 4% poly aery lamide-8M urea gels and autoradiographed. 
Lane 1 shows intron 5 RNA alone incubated in the reaction mixture. Lanes 2 and 
3 show the spliced products of intron 5 RNA incubated with native and his-tagged 
Cbp2 repectively. The input RNA and the spliced products are schematically 
represented on the left. 



41 



A. 



B. 



24 kDa 



15 kDa 



NHOH 

2 




NTCB 




1 



21.9 kDa* 
19.3 kDa* 



8.7 kDa* 
7 kDa 




42 
1974). While complete denaturation of the protein is essential to obtain cleavage 

at the internal sites, Cbp2, a relatively large protein (73.4 kDa), appears to be 
somewhat refractile even to the strong denaturation conditions employed in these 
cleavage reactions. Cleavage of crosslinked Cbp2-RNA complexes with NTCB 
(Figure 3-2, panel B) generated several peptides that retained the label. Among 
the various indirectly labeled peptides, the 7.0 kDa N-terminal peptide and its 
corresponding partials (indicated by asterisks) of sizes 8.7 and 19.3 kDa could be 
readily identified. This further supports the finding that the N-terminus comprises 
an important RNA binding domain. However, the 5.6 kDa C-terminal fragment 
generated by NTCB (identified by silver staining, data not shown) did not retain 
the label, suggesting that the extreme C-terminal region may not be important for 
Cbp2-RNA interactions. The putative C-terminal contact site identified by 
NH2OH cleavage may therefore be located upstream of this 5.6 kDa C-terminal 
fragment. 

In order to demonstrate that the conditions employed for UV-crosslinking 
promote the formation of active Cbp2-intron 5 RNA complexes, the reaction mixes 
were incubated with 0.2 mM GTP at 37 C for 30 minutes and the products were 
resolved on denaturing gels and autoradiographed. The results are shown in 
Figure 3-2, panel C. Reaction mixes containing either his-tagged (lane 3) or native 
Cbp2 (lane 2) protein clearly demonstrated splicing, while the RNA alone (lane 1) 
could not splice under similar low salt conditions. 



43 
The 6x histidine tag adds an additional 20 amino acid residues (about 2 kDa) to 

the N-terminus of the his-tagged Cbp2 protein. Therefore, the indirectly labeled 

N-terminal peptide and the partials obtained with his-tagged Cbp2 would migrate 

slower in the gels than their non-tagged counterparts. This difference in 

electrophoretic mobility was used as an analytical tool to confirm the assignment 

of the crosslink site to the N-terminal fragment (Figure 3-3, panels A and B). The 

NH2OH and NTCB digestion patterns of the crosslinked complexes using either 

his-tagged or native Cbp2 were compared on the same gel. The results for NH2OH 

cleavage reactions run on 15% tris-tricine gels are shown in Figure 3-3, panel A. 

The N-terminal peptide of the his-tagged protein (lane 2) obtained by NH2OH 

cleavage migrated at 24 kDa level while the non-tagged peptide (lane 1) migrated 

faster (at 21.6 kDa level). The C-terminal peptides derived from both versions 

exhibited similar mobilities, since the his-tag is present only at the N-terminus. 

The corresponding NTCB digests of both versions of crosslinked Cbp2 are shown 

in Figure 3-3, panel B. The N-terminal peptide (7kDa) and the corresponding 8.7 

and 19.3kDa partials (shown by asterisks) of his-tagged Cbp2 (lane 2) were shifted 

up in the 16.5 % tris-tricine gels compared to those generated from the native 

Cbp2 (lane 1). No other peptides shifted in the gel relative to the non-tagged 

version. These experiments showing differential mobility clearly demonstrate that 

the N-terminal crosslink site corresponds to the extreme N-terminal fragment. The 

minimal N-terminal peptide that crosslinked with intron 5 RNA was the 4.6 kDa 

peptide of the native Cbp2 that corresponds to the first 37 residues of the protein. 






Figure 3-3. Confirmation of the crosslink site in the N-terminus of Cbp2. 

Native and his-tagged Cbp2 proteins were crosslinked to 32 P-labeled intron 5 RNA 
and digested with hydroxylamine (panel A) and NTCB (panel B) as described in 
the legend to Figure 3-2. Lanes 1 and 2 represent the cleavage patterns of native 
and his-tagged Cbp2, respectively. Molecular weights of strongly crosslinked 
peptides are indicated by arrows, with asterisks representing partial cleavage 
products. Note the slower migration of N-terminal derived fragments in the his- 
tagged Cbp2 lanes. 



45 



A. 



13 
U 

CO 

so 

4-i 

c 

o 

Z 



-a 
o 

60 
bO 
ed 



21.6 kDa- 
15 kDa- 



■24 kDa 



B. 



*16.9 kDa- 



*6.3 kDa- 
4.6 kDa- 




19.3 kDa* 

8.7 kDa* 
7.0 kDa 



46 
Further analysis of the identified contact sites (Chapter 4) was restricted to the 

identified N-terminal fragment. However, certain conclusions can be drawn about 

the C-terminal fragment from the experiments described above. The 15 kDa C- 

terminal peptide generated by NH2OH cleavage showed strong crosslinking with 

intron 5 RNA (Figure 3-2, panel A). But the 5.6 kDa C-terminal fragment 

generated by NTCB (Figure 3-2, panel B) did not retain the label in crosslinking 

experiments. These results suggest that the 29.5 kDa penultimate C-terminal 

peptide of Cbp2 (aa 502-aa582) generated by NTCB has a potential RNA binding 

site. 

The summary of findings from the UV-crosslinking experiments are shown in 
Figure 3-4. The map shows the two strong RNA binding regions (hashed boxes) 
that have been identified by these experiments, with one site being in the first 37 
amino acids of the N-terminus and the other in a distally located C-terminal region 
(aa 502-aa 582). The digestion sites of NH2OH and NTCB on Cbp2 are also 
indicated in Figure 3-4. Further analysis of the importance of amino acid residues 
in the N-terminal fragment was carried out using site-directed mutagenesis 
(Chapter 4). 

Discussion 

UV-crosslinking is a powerful tool to identify RNA contact sites on a protein, 
especially when the primary structure and homology searches do not afford any 
clues about critical functional elements of the protein. Cbp2, required for the 



v\ & 




rrow 

age 

cids 






a > a 




ago 




o — c 




*», o *3 




w - 6 




CQ S m 




P 1 o 




H £ m 












"O 




w e <U 






55 &o q 




O C ^ 




tifi '0 -a 




c« c <u 
> ■= a, 






S3 *crt & 




u S si 




"2E 




<U O <u 




£ J E 




~ > S-> 




2 D * 




8 5^ <cL 




S ♦» JD 




&£<-> 




<o o c 




u u* s 




& fe ° 




53 • <u 




g fl .ts 


. 


M -g (0 




(11 <u 


<*> 


peptidi 
p2 prot 
osslink 


u 

X 

o 
13 


. The 
ngCb 
NAcr 




S £ * 


.5 


3 cd'n 
8 rt c 


ngr 

630 

intro 


U 

—-> 
i 


3.2 S 


U 


c * £ 


u 


S c „ 


is 


52 O en 


■M 




c 

. 1—1 


(S 


joe 


CO 




in 

C3 


O c/3 


r'l 


o 


££ 1 


in 


|e|> 




gure 3-4. Sumi 

d hyroxylamine 
suits shown in F 


c 


a 
w 

3 


a 




<u 


4-1 

1 

z 


<D 


£§£ 





48 



ZS£ 




CO 

u 
H 

Z 



o 



2 



zee 

soe 



OfrZ 



in 



091 
661 




49 
splicing of intron 5 RNA, fits into this profile of proteins. Nothing is known so far 

about the RNA contact sites on the protein while extensive studies are available on 
the RNA component of the system. In the studies reported here, UV-crosslinking 
was employed to determine the contact points of intron 5 RNA on Cbp2 in an 
attempt to investigate the functional interactions between this group I intron and its 
protein co-factor. The photocrosslinking studies were performed under conditions 
that favored the formation of stable protein-RNA complexes. The Mg levels (10 
mM) employed in these experiments were sufficient to promote 90-95% RNA 
binding to Cbp2 in equilibrium filter binding assays (data not shown), but splicing 
of RNA would not occur under these conditions due to the absence of guanosine 
(nucleophile). However, control experiments show that addition of GTP to the 
reaction facilitates splicing, demonstrating that the crosslinking conditions enable 
the formation of productive Cbp2-RNA complexes (Figure 3-2, panel C). 

Prior to determining the sites of crosslinking, it is essential to establish the 
specificity of crosslinking between the RNA and the protein in question. In 
control experiments, intron 5 RNA failed to crosslink to the non-cognate protein 
BSA (Figure 3-1), showing that photocrosslinking (zero-length crosslinking) can 
occur only between functionally interacting species. Also, Cbp2 proteins carrying 
mutations in the N-terminal domain showed reduced or no crosslinking with intron 
5 RNA compared to the wild-type protein (discussed in Chapter 4). Furthermore, 
Cbp2 does not facilitate splicing of intron 4 of COB pre-mRNA (Lewin, 
unpublished observation), a group I intron that also requires a protein co-factor in 



50 
vivo (Lamb et al, 1983; Banroques et al., 1986). Cbp2 protein is specific to intron 

5 RNA in its splicing-enhancing function. This corroborates the authenticity of the 
crosslinking results, as UV-light crosslinks an amino acid to its neighboring 
nucleic acid base only when present in a specific orientation (Williams and 
Konigsberg, 1991). The results of various experiments described above strongly 
suggest that the crosslinking conditions employed permit the structural probing of 
specific, functional interactions between Cbp2 and intron5 RNA. 

Precise identification of the residues that participate in photocrosslinking can be 
accomplished by amino acid analysis or amino acid sequencing, as described 
earlier. These conventional biochemical techniques, however, require crosslinking 
efficiencies of 20% or more. Unfortunately, low crosslinking efficiencies (less 
than 10%) were obtained under our conditions. Therefore, the RNA employed for 
some of the crosslinking experiments was double labeled with ct 32 P-UTP and a 32 P- 
ATP to increase the specific activity of RNA and enable detection of crosslinked 
peptides. There are several possibilities for the low yields of crosslinked product 
obtained in our system. Cbp2 and intron 5 RNA may have inherently poor 
tendencies to crosslink in spite of appreciable complex formation. On the other 
hand, exposure to UV-light could be causing significant photoinactivation of 
Cbp2. Photodamage of protein was reported to be a problem by other groups (Gott 
etal., 1991; Tanner et al., 1988). Finally, though UV-crosslinking indicates sites 
of protein-RNA contact, most of the affinity between protein and RNA may be 
attributable to contact sites that are not crosslinked under the conditions employed. 



51 



The low level of crosslinked product obtained in our system proved to be a 
potential problem for further biochemical characterization of crosslinked 
complexes. One of the ways to overcome this problem would be to enhance the 
photosensitivity of RNA using modified residues like 5-bromouridine or 5- 
iodouracil and using a monochromatic laser instead of a broad spectrum ultraviolet 
light. For instance, the amino acid residue Tyr 85 of R17 bacteriophage coat 
protein was shown to be crosslinked with singly BrU-substituted hairpin RNA 1 
(Gott et al, 1991) using a monochromatic XeCl excimer laser (308 nm) that 
yielded crosslinking levels exceeding 50%. Substitution of 5-iodouracil for uracil 
in the binding site for bacteriophage R17 coat protein improved crosslinking levels 
to 80% in less than 5 minutes of irradiation (Willis et al, 1993). However, 
incorporation of 5-BrU into intron 5 RNA significantly reduced its autocatalytic 
activity, indicating that the structure of the ribozyme was perturbed (data not 
shown). Also, our attempts to crosslink Cbp2 protein with 5-BrU-RNA using a 
broad spectrum UV-source (Stratal inker) did not significantly enhance the extent 
of crosslinking. Since we did not have ready access to a monochromatic laser, we 
opted to employ alternative analytical methods which accommodate low 
crosslinking efficiencies. 

A popular approach to analyze crosslinked complexes obtained at low yields is 
to employ extremely sensitive analytical techniques like Matrix-assisted, laser 
desorption/ionization-time of flight (MALDI-TOF) mass spectrometry (Karas and 



52 
Hillenkamp, 1988; Beavis and Chait, 1990 and Hillenkamp et al., 1991) and ladder 

sequencing (Chait et al., 1993), which typically require 10-15% crosslinking 
efficiency. Elaborate attempts were made to identify the crosslinked 
peptides/amino acid residues using this approach in collaboration with the Protein 
Core facility of the Interdisciplinary Center for Biotechnology Research (ICBR), 
University of Florida. Unfortunately, all attempts failed due to various technical 
problems including difficulty in removal of SDS, Coommassie Blue and other gel- 
derived contaminants from the peptides. Consequently, the indirectly labeled 
Cbp2 peptides (crosslinked with intron 5 RNA) were identified by size separation 
on tris-tricine gels followed by Phosphorlmager analysis (Figures 3-2 and 3-3). 
Non-enzymatic cleavage agents were used instead of proteases to avoid 
interference from protease-derived peptides resulting from self-cleavage. Of 
several chemical cleavage reagents, hydroxylamine was chosen for the initial 
analysis of crosslinked complexes as it generates only a few large peptides in Cbp2 
that can be readily identified on high percentage tris-tricine gels. NTCB was 
selected as a secondary reagent to further narrow down the contact points on Cbp2. 

Chemical cleavage of the protein-RNA complexes with NFbOH and NTCB 
showed that the termini of Cbp2 comprise important RNA binding domains, while 
several stretches in the central core of the protein may contribute to the overall 
stabilization of protein-RNA interactions (Figures 3-4). Experiments with his- 
tagged and native versions of Cbp2 (Figure 3-3) unambiguously demonstrate that 
the first 37 amino acids in the N-terminus of Cbp2 constitute a strong RNA contact 



53 
site. A second site may be located in the C-terminus between residues 502 and 

582 of the protein. A similar architecture of RNA binding domains has been 
demonstrated with the mitochondrial tyrosyl-tRNA synthetase protein (Cyt- 1 8) of 
Neurospora which is essential for splicing several mitochondrial group I introns in 
addition to aminoacylation of tRNA yr (Akins and Lambowitz, 1987). The regions 
required for splicing are distributed throughout the Cyt- 18 protein, as it binds the 
precursor RNA and facilitates formation of the catalytic RNA structure. These 
regions overlap with the stretches required for synthetase activity but are not 
identical to them. However, the principal RNA binding regions include a small, 
idiosyncratic N-terminal domain significantly absent in bacterial tyrosyl-tRNA 
synthetases (Cherniack et al., 1990) and a C-terminal tRNA-binding domain 
required for both splicing and synthetase activities (Kittle et al., 1991). 

A comparison of Cyt 1 8 binding sites in N. crassa mt LSU and ND 1 introns 
with that in N. crassa mt tRNA yr has revealed a remarkable three-dimensional 
overlap between the tRNA and the catalytic core of group I introns, suggesting an 
evolutionary relationship between group I introns and tRNA and perhaps the 
evolution of RNA splicing factors from cellular RNA-binding proteins (Caprara et 
al., 1996). Adaptation of a synthetase to facilitate group I intron splicing appears 
to be a relatively recent evolutionary improvement as it has been reported in only 
one other closely related fungus, Podospora anserina (Cherniack et al, 1990; 
Lambowitz and Perlman, 1990 and Kamper et al., 1992). 



54 
Cbp2 protein does not possess any sequence homology with Cyt 18 ofN. crassa 

or Ytsl protein of P. anserina. However, the latter two share three blocks of 

amino acids required for splicing, of which one corresponds to the idiosyncratic N- 

terminal domain of Cyt- 18, while the other two are located in the putative C- 

terminal tRNA binding domain. Although Cbp2 is not a bifunctional protein, the 

structural similarities between the catalytic core of group I introns and tRNA may 

point to a common mechanism of recognition of a conserved tRNA-like structural 

motif in its cognate intron, intron 5 RNA. 



CHAPTER 4 
MUTATIONAL ANALYSIS OF THE N-TERMINUS OF CBP2 



Introduction 

UV-crosslinking studies (Chapter 3) show that the N- and C-termini of Cbp2 
intimately contact intron 5 RNA. Now the challenge is to identify which amino 
acids in these regions are important for Cbp2 function. Unlike most other RNA- 
binding proteins, Cbp2 does not contain any well-characterized RNA binding 
motifs like the RGG box, RNP or KH motif (Burd and Dreyfuss, 1994). However, 
Cbp2 is rich in basic and hydrophobic amino acids, which is also a characteristic of 
double stranded RNA-binding proteins (St Johnston et al., 1992; Gatignol et al, 
1993). The only protein with which Cbp2 displays any homology is its counterpart 
in S. douglasii (Li et al, 1996). However, the extremely high identity (87%) 
between the two homologs does not lend itself to the identification of potential 
RNA binding domains by sequence alignments. Therefore, the only viable 
alternative is to identify the important residues by biochemical or genetic methods. 
The low crosslinking efficiencies obtained in our system ruled out the use of 
biochemical methods such as anion-exchange HPLC or mass spectrometry to 
identify the critical residues. Therefore, site-directed mutagenesis was used to 
identify critical residues for Cbp2 function. 

55 



56 
Site-directed mutagenesis is a powerful tool to study the structure-function 

relationship of single or combinations of amino acid residues in proteins. It has 
been classically used in probing various RNA-protein interactions. One of the 
many applications of this technique has been to dissect the individual functions of 
various amino acids in dual-function proteins. For instance, the MS2 (R17) 
bacteriophage coat protein which binds and encapsidates viral RNA also acts as a 
translational repressor of viral replicase by binding to an RNA hairpin in the RNA 
genome. LeCuyer et al, 1995, LeCuyer et al, 1996) successfully studied the RNA 
binding properties of MS2 coat protein independent of capsid assembly by 
isolating a Val75Glu; Ala81Gly double-mutant coat protein which had wild-type- 
like affinity and specificity for RNA, but was defective in capsid assembly. 

Site-directed mutagenesis has also been employed to study the evolutionary 
relationships of RNA-binding proteins in various species. For example, the second 
intron (bi2) of cyt b gene has two homologs in related Saccharomyces species that 
differ in their mobility. The S. capensis intron product is bifunctional, with both a 
DNA endonuclease and an RNA maturase function (Lazowska et al, 1992; 
Szczepanek and Lazowska, 1996), whereas the homologous S. cerevisiae intron 
product has only an RNA maturase function and is not mobile (Meunier et al, 
1990; Lazowska et al, 1992). These two intron-encoded proteins differ by only 
four amino acid substitutions. Mutational analysis showed that replacement of two 
non-adjacent amino acids (Thr212Ala; Thr239His) in the S. cerevisiae maturase 
was necessary and sufficient for the acquisition of an endonuclease activity 



57 
promoting intron mobility (Szczepanek and Lazowska, 1996). Thus, the S. 

capensis protein could be considered more primitive in terms of mitochondrial 

group I intron-encoded protein evolution as the two activities have not yet 

diverged. The S. cerevisiae protein, on the other hand, lost the original function 

(intron mobility) and maintained the acquired one (RNA maturase function) during 

evolution. 

Site-directed mutagenesis has been instrumental in delineating novel RNA 
binding motifs of proteins with little or no sequence homology to known RNA 
binding consensus sequences. The viral coat proteins of the plant viruses alfalfa 
mosaic virus (AMV) and tobacco streak virus (TSV) share little primary amino 
acid sequence identity (van Vloten-Doting, 1975; Reusken et al, 1995), but are 
functionally interchangeable in RNA binding (Zuidema and Jaspars, 1984) and 
initiation of infection (Gonsalves and Garnsey, 1975). The lysine-rich N-terminal 
RNA binding domain of the AMV coat protein lacks previously identified RNA 
binding motifs. Mutational analysis of this N-terminal region identified a single 
arginine whose specific side chain and position were crucial for RNA binding 
(Ansel McKinney et al., 1996). Consequently, protein sequence alignments 
between AMV, TSV, and other related viruses centered on this key arginine 
residue revealed a new RNA binding consensus sequence. This also explained in 
part why heterologous viral RNA-coat protein mixtures were infectious. 

In the case of Cbp2, we employed site-directed mutagenesis to identify the 
important residues (by either partial or complete loss of Cbp2 function) in the N- 



58 
terminus that crosslinked to intron 5 RNA. The C-terminal region that strongly 

crosslinked to RNA was not pursued further, as attempts to narrow down this 

region by double digestion of crosslinked complexes with NH2OH followed by 

cyanogen bromide were not feasible within the resolution of our gel system. 

In order to identify targets for site-directed mutagenesis of Cbp2, the putative 

N-terminal RNA contact site on Cbp2 (spanning 37 residues) was scanned closely 

to allow the prediction of residues that might be important in RNA-protein 

interactions. This sequence, aal7 SSSRYRYKFNME aa28, has the following 

interesting features: 

a. Charged residues alternate with aromatic residues. 

b. Polar residues flank the region of alternating charged and aromatic residues. 
While the charges could promote ionic interactions between protein and RNA, the 
aromatic residues could engage in stacking interactions. The stretch of serines 
could participate in hydrogen bonding interactions. These various possibilities led 
us to target this N-terminal region (aal7-aa28) for site-directed mutagenesis. The 
details of the analyses of all these mutants and a discussion of their implications 
are described in the following sections. 

Results 
All mutant his-tagged Cbp2 proteins (Table 4-1) were purified by one-step 
metal affinity chromatography as described in Materials and Methods. The serine 
deletion mutant and the Y23L mutant could not be successfully purified. The 



59 



Table 4-1. Description of Cbp2 mutants 



Name of Mutant 



Deletion mutant 



Triple aromatic mutant 



Triple charged mutant 



Y21L mutant 



Y23L mutant 



F25L mutant 



Serine deletion mutant 



Mutant Description 



Deletion of aal7-aa28 



Changes Y 2[ , Y 2 3, and F 25 to L 



Changes R 2 q, R 22 , and K 24 to L 



Changes Y 2) to L 



Changes Y 23 to L 



Changes F 25 to L 



Deletion of S17, S )8 , and S19 



60 

former eluted in the wash fractions with other E.coli proteins, while the latter co- 
purified with a nuclease activity and could not be assayed. The serine deletion 
appears to have altered the global conformation of Cbp2 (perhaps the topology of 
the histidine tag), resulting in poor binding to the nickel column. Independent 
attempts to purify the Y23L mutant with fresh reagents and columns still yielded 
preparations with high nuclease activity, raising the possibility that this mutation 
has conferred a nuclease function to Cbp2. This problem was not encountered in 
parallel preparations of any of the other mutants. Although these mutants appear 
to possess interesting properties, they were not characterized further. 

The mutant Cbp2 proteins purified from E.coli were first analyzed by Western 
blotting with a Cbp2-specific polyclonal antibody to check for production of the 
full-length protein. Mutant proteins were separated on a 10% SDS-polyacrylamide 
gel and electroblotted to a nitrocellulose membrane at 15 volts, overnight. The 
membrane was first probed with Cbp2-specific primary antibody followed by 
secondary goat anti-rabbit antibody as described by Towbin et al. (1979). The 
Cbp2 bands were detected by chemiluminescence using ECL detection system 
(Amersham) (Figure 4-1, panel A and panel B). All mutant proteins (in both 
panels) except the deletion mutant (lacking aal7-aa28) exhibited electrophoretic 
mobilities similar to that of wild-type Cbp2. The deletion mutant (aa 17-aa28) was 
shorter by about 1 .3 kDa, as expected. These data confirm the synthesis of full 
length mutant Cbp2 proteins in E. coli. To test the effects of these mutations on 
splicing function, in vitro splicing assays were carried out. 32 P-labeled intron 5 



C 

J ti M 



-t 

a 

c 



i -o 

wa e 

Q rt 

vp "5 

o^ O 

O X) 



T3 c3 

D G 

> O 

"3 3 

CO >-> 

J) --< 

E O 

o> ex 

CD ,S 

.1 ft. 

CD M 

-4— * * 

O <N 

5 °^ 

ft. X) 

(N O 

•&£ 

1 J 

"^ CO 

T3 U 

6 £ 



2 "J 

.2 - 

— I CD 

*J " c 

CO ». — - 1 

d d 

C C3 



u 

CO 

o 



e3 J£ 

o C 



CCS 



o 



^SJ 



to 



E 

E 
u 

CO 

O 
C8 53 

E 2 

■<-> 

ci. c 

X! O 

<*« CD 
09 O 



fS 

ft 

X) 

u 

u 
a 



» 2 

d -r; 
ccj £ 



O CD 

5 S 

c3 ccj 

CO 

12 

< CD 

O B 

§i 

a U 



09 


o 


3 








■M 

o 




1 




a 


E 


2 




03 

C 


CJ 

u 


o 
o 


"5 




o 


y; 


ij 


rn 


J 


co 


CO 


U 


u 

d 






o 


U2 


_2 


>H 


-a 


CO 


. f. 


«. 


fH 


e 




d 

C3 


in 


| 


Co 


^ 


■M 


d 




O 


-a 
u 


3 

E 


j 


3 


o 
OJ 


oo 


* — i 




o o 
ft. -a 


C3 


> 



62 



CO 




(83-Zl) uopapa 




63 

RNA transcripts were incubated with increasing concentrations of wild-type or 
mutant Cbp2 proteins under low salt splicing conditions. The reaction products 
were separated on 4% polyacrylamide-8M urea gels and autoradiographed (Figure 
4-2). Increasing concentrations of deletion mutant (aal7-aa28) (lanes 4 and 5) and 
triple aromatic mutant (lanes 6 and 7) failed to stimulate splicing of intron 5 RNA, 
while wild-type Cbp2 spliced normally at both concentrations tested (lanes 2 and 
3). These results strongly suggest that the N-terminal residues (aal7-aa28) may 
comprise an important RNA binding domain essential for Cbp2 function. 
However, it is important to demonstrate that the loss of activity observed was not 
due to structural destabilization caused by these mutations. 

Partial proteolysis is a useful technique to analyze the conformational states of 
proteins (Chang and Doi, 1993; Hay and Nicholson, 1993; Petersen et al, 1995; 
Ikeda et al, 1996; Liu et al, 1996). In this assay, deletion and triple aromatic 
mutant proteins (in native states) were incubated separately with trypsin under 
conditions that favored partial proteolysis as described in Materials and Methods. 
A control digest with native or heat-denatured wild-type Cbp2 was also done. The 
peptides were resolved on 12% SDS-PAGE gels and detected by Western blotting 
with a Cbp2-specific polyclonal antibody (Figure 4-3). The tryptic peptide profiles 
of native deletion (lanes 3 and 4, panel A) and triple aromatic (lanes 3 and 4, panel 
B) mutants closely resembled the pattern obtained with native wild-type Cbp2 
(lanes 5 and 6 of both panels). In contrast, heat-treated wild-type samples (lanes 1 
and 2 of both panels) exhibited a different pattern, showing aggregation of 



Figure 4-2. Functional analysis of deletion (aal7-aa28) and triple aromatic 
mutants. 32 P-labeled intron 5 RNA was incubated with increasing concentrations 
of wild-type and mutant Cbp2 under low salt splicing conditions at 37°C for 1 
hour, ethanol precipitated, resolved on a 4% polyacrylamide-8M urea gel, and 
autoradiographed. The precursor RNA and the products of splicing are 
schematically represented on the left side of the gel, with the ratio of protein to 
RNA shown on top of the lanes. Lane 1, precursor RNA alone; lanes 2 and 3, 
incubation with wild-type Cbp2; lanes 4 and 5, incubation with deletion (aal7- 
aa28); lanes 6 and 7, incubation with triple aromatic mutant (Y21, Y23, F25 to L). 



65 



m 



00 


gg 


u nS 


nj H 


O a 


. « 


56 


0) j 


qj n3 




D S 


H 



Protein : RNA 



i»< 



t 



•<* 




u 

-a u j2 S 
£ — .2 c 

3 O l-< _r 
-P oo 0) VO 

g e s ^ 

a <* a 
2 c v-i 

&o 



U 



cd V- » 



d wa -a 






,.8»« 

o -a ui 

S3 H 

•7 S «« 3 

A ft (S g 

• >^ >* e 

b *a *s 



u 

"3 t3 

3 3 

ca .a 

03 
&0 



o .a 

S c u 
> — i 

OS'* 
i — i S t— t 

a o g 

I W "o 03 
Ct A3 ft J> 

S 5 8«a 

** <u ft 3, 



c 

« 

a 
E 



« 



o 



o3 



s 

o 
u 



ft 

■e\2 

* 03 

d o 
en +- 1 

3 H 



(N 

ft 

u 



00 

ft 

E 

c 



u 



c 



ft u 



ea 



c ja ft 

~"ft^ 

M "Q *o 

C > Jj ^ 
O -o O 3 

"5 " -° § 

— M r- W 
u l) H J) 

■3 .SP § "? 

° V 

(/J >-i 






CO 

M 

o 
- 






03 



0) 00 



03 



.2 o « 

6 S ou n 



c 3 § 



^ <L> 



>> ft 

I | 3 J 

g 3 « 

ft S "^< 
wot; 

> p 8 

■■a -^ « 

§ O ft 

c ft 
m rt Q o 

^ ft. o J 

*■ i CM 

3 -O ^h 
WD — 

•■" "C 3 

ta > o 



.5 
°-3 
- 

ft 



u 



JD 03 

U o, 

(D .3 

K © 

|!s 

u o 

3 C^ 
ed -3 
3 ° 

■ t-i 

% a 

>* g 

"O — 
3 <U 

«* ts 

»-i o 

<D ft 
3 3 
03 "O 

i—l <u 

. r^ 

PQ H 

o d • 
3 ft Yl 

"O ■ — ' 
U 3 U 
ft ^ J3 

'I g-S 



67 



Zd<\D JM 



(iXTOTH) 

opeuioie ajdxix 

2dcQ}M 
pajn;Buap-}B8H 



OS^I 


/ 


' 1 


001 = I 


1 


i / 


" 05=1 


1 


i ! 


001=1 


i 




"os : x 


i 




001=1 







SO 

in 

m 



PQ 



(N 



.5 



Zdqo JM 



[0S : I 
001=1 
)fOS:T 



(8ZKB-/XBB 

U ° Waiaa L00i:i 



ZdcQ}M 

pamjBuap-ieaH 



0S=l 
001=1 







.S 



H 



68 
denatured protein at the top of the gel. In addition, partial products corresponding 

to those obtained with native proteins were markedly absent in these digests. This 

is probably due to complete degradation of denatured protein molecules that were 

not present in aggregates. Thus, these results demonstrate that the mutations in 

Cbp2 did not alter the global conformation of these proteins. 

Preliminary splicing experiments with triple charged mutant (R20, R22, K24 

changed to leucine) and two point mutants, namely Y21L (tyrosine to leucine 

change at position 21) and F25L (phenylalanine to leucine at position 25), showed 

varying degrees of activity. These mutants were characterized further by a series 

of time-course experiments that measured their initial rates of splicing (Figures 4-4 

32 

and 4-5). P-labeled transcripts were pre-incubated with each mutant protein at 
37 C for 10 minutes under low salt conditions and splicing was initiated by the 
addition of 0.2 mM GTP. The reactions were terminated at different times, 
resolved on denaturing polyacrylamide gels (Figure 4-4A & B) and 
autoradiographed. The F25L mutant (Figure 4-4A, right panel) stimulated splicing 
at levels comparable to wild-type Cbp2 (Figure 4-4A, left panel), while the triple 
charged and Y21L mutants (Figure 4-4B, left and right panels, respectively) 
showed drastic reduction in the extent of splicing. It is interesting to note that in 
the case of triple charged and Y21L mutants (compare Figures 4-4 A and 4-4B), 
the products of the first step of splicing (5' exon and the intron-3' exon) were 
barely detectable compared to the products of the second step (ligated exons and 
free intron), suggesting that the first step of splicing is rate limiting for these two 



m 



Rj 



Lo 
£ 



60 



W 



o 



LO 






70 



m 



CM 

u 




71 



,09 J* }M 




o 




CM 






c 

s 


O 
i— I 

00 


i— 1 






CN 




i— I 




o 



,09 ve »M 




o 




VO 




^ 




(N 


+-> 


CN 


c 


I-H 


n3 






o 

I-H 


13 


oo 


OJ 




00 




|H 


vO 


CO 




X 




u 


■* 


QJ 








• t— < 


CN 


M 




H 





It 1 1 




1 

1 :' 

1 J 
I 2 


IB 1 1 

R 



T3 

U 

3 

d 

€ 

o 
o 



4 

o 



31 i 



D 



QJ 



PQ 



Figure 4-5. Splicing rates of wild-type and mutant Cbp2. The gels shown in 
Figure 4-4 were quantitated using Phosphorlmager and the RNA fraction spliced 
calculated as the ratio of the sum of ligated exons and free 5' exon to the exon 
sequences present in the precursor RNA. The plots show RNA fraction spliced 
(+/-S.D) vs. time in min. A. Filled circles, Wt Cbp2; open circles, F25L mutant; 
filled squares, Triple charged (LYLYLF) mutant; open squares, Y21L mutant. B. 
The plots for the last two mutants shown in A are plotted on an expanded scale to 
show initial rates of splicing. Filled circles, Triple charged (LYLYLF) mutant; 
open circles, Y21L mutant. 



73 



A. 



CD 

u 



CO 

C 

o 

■H 
O 

m 
M 

< 

a: 




Time (min] 



74 



B 



0.08 - 



X) 




CD 

n 


0.06 


-H 




rH 




O, 




en 




C 







0.04 


+J 




U 




05 




M 




m 




rt 


0.02 


z 




0(3 





0.00 




Time (min) 



Figure 4-5... continued 



75 
mutants. A quantitative representation of splicing for the wild-type and mutant 

proteins is shown in Figure 4-5 A. A re-plot of the data corresponding to triple 

charged and Y21L mutants is shown on an expanded scale in Figure 4-5B. Initial 

rates of splicing were calculated from the above plots for all mutants (Table 4-2). 

Figure 4-5 A shows that the triple charged (filled squares) and the Y21L (open 

squares) mutants exhibited extremely low activity compared to F25L mutant (open 

circles) or wild-type Cbp2 (filled circles). However, it is obvious from Figure 4- 

5B that both triple charged and Y21L mutants accumulated spliced products with 

time. Initial rate measurements (Table 4-2) indicated that the rate of splicing of 

the F25L mutant, though appreciable, was slightly lower than that of the wild-type 

protein. In the case of the Y21L and triple charged mutants, the initial rate of 

splicing was lowered by ~45-fold and ~40-fold, respectively, in comparison to 

wild-type Cbp2. Thus, tyrosine at position 21 is critical for activity while a 

phenylalanine at position 25 is dispensable. The charged residues at positions 20, 

22 and 24 are also important for Cbp2 function. 

To determine if lower splicing activity of the Cbp2 mutants corresponded to a 

reduction in overall affinity for intron 5 RNA, equilibrium binding assays were 

performed. P-labeled intron 5 RNA (16 pM) was incubated with increasing 

concentrations of wild-type or mutant Cbp2 (0-4000 pM) at 37°C for 30 minutes 

and equal aliquots were filtered in duplicate through a double-filter consisting of 

nitrocellulose on top and charged nylon at the bottom, as described in Materials 

and Methods. Representative filter binding data are shown in Figure 4-6 A. The 



76 



Table 4-2. Rate measurements for wild type and mutant Cbp2 



Cbp2 protein 



Wild-type 



F25L 



LYLYLF 



Y21L 



RNA fraction spliced 
at 60 minutes 



0.94 ±0.22 



0.6810.09 



0.11 ±0.01 



0.05 ±0.0005 



Initial rate of splicing 



■h 



(fraction min" ) 



0.189 



0.162 



0.474x10" 



0.417x10" 



o 

m 

u 

-S £ 

-o r- 

+- > * ' 
03 -I-; 
J3 cd 

3 <«-. 

•9 E 

CO O 

^ o 



d 
a 



in 

Ph 
T3 



ii a 



-a 
u 

00 
H 

cd 

o 



cd 

< H 
d . 

d "s 
x 5 



-"-■ M —-. 



^3 rd 

fa - 

Cd CO 

X <L) 

° M 



n "3 

J2 d 

n cd 



— ) <l) ■!-» 



eg 

a 

o 



P 



d d 



"O co 

<u d 
u o * 
-o £» .2 

1 CO 

d 
o 
u 






d co 



CO 

B.SB 



o d 
rt 00 



c^ 



c .» 



p, 

6 « 

d £ 

£ h x 



cd 
00 

c 
d 



? £ 



o 

CO 

CD 
H 






. -a 

co tU 

y rd 

cd Id 

P .- 

60 tn 

"O (N 

« Ph 



CO 
U 



O 

CO 

U 

CO 

03 



•a 

d -V 

CO <, 

S3 Z 

00 



y 

S d 

« d 

a, 3 

O. P 



53 X! 
o ^ 

x -o 
& S 

3 03 
"O co 



x o 
60 c3 
"C <-> 

I § 

1.8 

cd f-J 



P,.3 



d c3 



2 i 

■g £ 

^ *° 

« Ph 

00 £? 

d J, 

T3 rd 

.s % 

X '— 

i ° 

aj co 

5 d 

S ° 

<U c3 



*d u 

iC d 



CD d 

d o 

c3 *>j 
Pi C 

CD 



hJ 

(S 

>H 

CO* 

O 
H 

r3 

d 

o- 
co 

c 
cu 
P, 
O 

d 
o 

■ ^H 

C3 
u. 

d 

CD 
O 

d 
o 
o 

ts 

p 

x 



CO 

d 

C3 



d 

CD 
P 

o 



c 

-2 
"5 

E 
o 

. ^^ 

cd 

s 

c 
« 

xV 



CO' 

u 






T3 

E 



CD 
X 





X) 


CD 


CD 


£ 


X 


d 


'C 

CD 


o 


CO 


• p— 


CD 


o 


13 


<"3 


CO 


CD 


C3 


X 
CD 


B 


c3 


o 


CD 


J3 


c^ 


O 



-o 

c 

C3 



CD 
O 

o 

H 



d 

d 

o 



o 
d 

00 rt 

§ 2 

6 S 



o u 

X J3 

p o 

CN co —< 

ftO ft 
X X oo 

O P^ '~ 



O X 
c« 4) 



CD 
P 



« g CO <D >T 

S -d * x & 



x 
= 

o 

Q 



d 

CD 

o 

d 

o 

CD 

00 

d 



SO 

i 

O CO 

i. cd 

g g 

ox 

fa .9 



CD ■>-> 

3 *- 

cr c3 

*C3 >i 

d d 



a cr 



I 

-a 



T3 

G 
c3 



W CD 
00 

d cd 

in 



-O 6fl 



d 

cd 
-;— i 

d 

£ 



00 

_d 

'co 

-a 

CD 
-»— I 

d 

d 

cr 

CD 
Ih 

CD 



d 
o 

X 

< •£ 



ri 

C3 

r3 

i 

t-> 

cd 

cd 

d 

.2 

'-^ 

_H 

CD 

-a 

co' 

JD 

CD 
Ui 



(4H 

o 

d 
_c 
'-*— < 

CD 

cd 
c*h 



d 

CD 

y x 

d U 



CD 



78 



+ 

c 

o 

2: 



C 



CU 

u 

O 




79 




3, 

in 
a, 

U 



13 

CD 

5 

»H 

C 

o 
u 



H 



CQ 



punoq VNH uoipejj 



80 
nitrocellulose membrane, which contains protein-RNA complexes (left panel) 

showed an increase in the bound RNA fraction with increasing Cbp2 

concentrations, while the nylon membrane which contains free RNA (right panel) 

showed a corresponding decrease in the free RNA retained. Each filter binding 

experiment (in duplicate) was repeated at least two times and the RNA binding 

data (Figure 4-6B) used to calculate dissociation constants (kd) (Table 4-3). 

The F25L mutant (open triangles), which showed wild-type-like splicing 

activity, demonstrated RNA binding levels comparable to that of wild-type (filled 

triangles). The kd values of wild-type protein and F25L mutant were very similar 

(147 pM and 143 pM respectively). The triple charged (filled squares) and the 

Y21L mutants (open squares), which displayed partial splicing activity, showed 

reduced binding. These two mutants showed ~2. 5-fold and ~5-fold increase in kd 

values, respectively, relative to wild-type Cbp2. The deletion mutant (open 

circles) showed slightly tighter binding (kd of 77 pM) than wild-type, whereas the 

triple aromatic mutant (filled circles) showed slightly lower binding levels (kd of 

184 pM) compared to wild-type Cbp2. Although the kd values are variable, the 

overall RNA binding profiles of mutants are similar to that of wild-type Cbp2 

(hyperbolic). The similarity in binding isotherms for most of the mutant proteins 

confirms our conclusion that the amino acid changes have not significantly 

destabilized the higher order structure of protein. These results also suggest that 

the overall RNA binding pattern does not necessarily reflect the ability to stimulate 

splicing of intron 5 RNA. 



81 



Table 4-3. Dissociation constants of Cbp2 mutants 



Cbp2 protein 


k d (pM) 


Deletion (aal7-aa28) 


77 


Wild type Cbp2 


147 


F25L mutant 


143 


Triple aromatic mutant 
(Y„,Y M ,andF25toL) 


184 


Triple charged mutant 
(R 20 , R22, and K 24 to L) 


367 


Y21L mutant 


710 



82 



Since the putative contact sites in Cbp2 were initially identified by UV- 
crosslinking, the mutants were tested for their ability to crosslink to intron 5 RNA. 
32 P labeled RNA transcripts were UV-crosslinked to wild type or mutant Cbp2 
protein, RNAase treated and resolved on 10% SDS-polyacrylamide gels. The 
crosslinked complexes were detected by autoradiography (Figure 4-7) and 
quantitated using Phosphorlmager. RNA crosslinked in the absence of protein 
(lane 5) was almost completely degraded, without any detectable complexes. 
However, RNA crosslinked to wild type Cbp2 (lane 4) showed a prominent 
crosslinked species corresponding to the molecular weight of Cbp2. Crosslinking 
to triple charged (lane 3) and F25L (lane 1) mutant proteins was reduced by -50% 
and -53%, respectively, compared to wild type. The Y21L mutant (lane 2) 
showed extremely poor crosslinking to intron 5 RNA. The background bands seen 
below the level of Cbp2 (lanes 1 to 4) could be photodamaged Cbp2-RNA 
complexes or RNA-RNA crosslinks that were resistant to RNAase. Thus, 
mutations at positions R22, R24, K26, Y21 and F25 lowered the crosslinking 
efficiency of Cbp2. It is important to note that mutations targeting the above 
residues also affected splicing, with the exception of the F25L mutation. Thus, 
some of the residues in this region (aal7-aa28) that are important for Cbp2 
function also appear to be involved in crosslinking Cbp2 to intron 5 RNA. 

As partial proteolytic profiles (Figure 4-3) and filter binding curves (Figure 4- 
6B) of deletion (aal7-aa28) and triple aromatic mutants were similar to that of 



Figure 4-7. UV-crosslinking of wild-type and mutant Cbp2 to intron 5 RNA. 

Wild-type or mutant Cbp2 was incubated with radiolabeled intron 5 RNA under 
low salt conditions in the presence of 20 ug/ml tRNA. The samples were then UV- 
crosslinked at 600 mJ, extensively RNAase treated, resolved on 10% SDS-PAGE 
gels, and autoradiographed as described in Materials and Methods. Lane 1, F25L 
mutant; lane 2, Y21L mutant; lane 3, triple charged (LYLYLF) mutant; lane 4, 
wild-type Cbp2; lane 5, radiolabeled RNA alone. The molecular weight position 
of Cbp2 is indicated by the arrow. 



84 



-J 

IT) 
<N 

Ph 






-J 



1 

03 

< 

Z 

2 



74 kD 




2 3 4 5 



85 
wild-type, they were tested for their ability to compete with wild-type Cbp2 in 

splicing assays. Splicing reactions were set up at wild-type Cbp2 to intron 5 RNA 
ratio of 7:1 in the presence of increasing concentrations of mutant proteins. 
Reaction products were resolved on denaturing gels and autoradiographed (Figure 
4-8A). Wild-type Cbp2 alone (lane 1) spliced normally while the deletion (lane 2) 
or triple aromatic (lane 7) mutant alone was completely defective in splicing 
activity, as reported before. Addition of increasing concentrations of deletion 
(lanes 3 to 6) or triple aromatic (lanes 8 to 11) mutant protein to wild-type Cbp2- 
mediated reactions showed a progressive inhibition of splicing (compare lane 1 
with lanes 3 to 6 and 8 to 11). These results are quantitatively represented in 
Figure 4-8B. The graphs show percentage splicing as a function of mutant: wild- 
type ratios, with the extent of splicing obtained in the presence of wild-type Cbp2 
alone set to 100%. Results of the addition of deletion and triple aromatic mutants 
are shown in the left and right panels, respectively. Addition of a 3-fold excess of 
deletion mutant lowered splicing levels to 40% of control levels. A similar 
inhibition of splicing was observed with triple aromatic mutant, although at a 
higher ratio (9:1) of mutant to wild-type Cbp2. Thus, Cbp2 mutants inhibited the 
protein-mediated splicing of intron 5 RNA when present in excess over the wild- 
type protein. 

It is important to note that at the highest level of splicing inhibition (Figure 4- 
8B), total protein (mutant + wild-type) to RNA ratio was 71:1 for the deletion 
mutant and 140:1 for the triple aromatic mutant. It is, therefore, possible that the 



€ 
-a 

£ 

s- 

eg 

In 

u 

u 

s- 

O 



to u 

d c 
u — 

■a • « 

o <u 
ft 



d 



c 
3 

a 

d 

o 



u 



(4H 

o 



od 

s 

o 
Ed 
u 



c3 

cn « 

ft u 

CD © 
ft 

$ 



CO CD 

d J3 

.2 H 



C3 



J 22 



2 ft^; 



o 

ed 

CD 

60 



o 

00 " 



CD 

d 
5 

-J 



.a is 

O Cd 

yg ea 
i 



r- 

cd 

ea 

d 

"3 

« o 



C/3 

e 



a 

CO 



Gfl 

2 

.2 
'•^ 
ea 

H 

d 
u 
o 

d 
c 
o 

M 

d 

< a 

u 

CD g 

x -a 

•I ^ 

cci T3 



2 £ 

< I 
.s e 

co <+- 
O 



8 « 

S u 

2 rS 

d > 



u 

bX) d 

bfi.2 

.S o 
o d 



CO 

u 

Ih 
O 

.9 
+ 
u 
a. 

5 



o 

X3 

Cd 

CD 

o 

• —t 

d 



CO 

CD 



03 



CO 

ed 



ed 
€ 

X! 
O 

CO 

O 
C 

53 
ft 

bfj 



pq 



-a 

o 

E 

i 

<N 

ft 

u 



C 

3 



u 



CO 

d 

.2 

ed 
E 

d 

CD 
O 

d 
c 
o 

bO ^ 
d oo 

• t— < 

CO 

3 

CD 



O 

d 

o 
E 



c 

d 
p 

o 

2 



d 

*-+— > 
o 
ed 

CD 
I* 

.a 

o 

CD 



-a 

CD 

• 7^ d 
bO CO qG 

d 

o 
x 

CD 

T3 

CD 



d 

C3 



00 od 



td 

CD 



d 
to oo 



CN 
& 

X) 

U 

CD 

.. a, 
1 B 



CO 

d 

o 
o 



CD 

4-1 

o 

CD 

CD 

d 

o 

CD 

d 

CD 

CO 
CD 
!-< 

CD 



CD 

H 



— o 

6 - 

o o 



^ "M »L *ri 

3 co OO Js 



Pi ^ 



G 
O 
O 



CO 
CD 

d 



c 

o 

CO 

C 

o 

a 

03 



5 ^ 

a co 

6 9 

CD — ' 

O o 



•> cd 






o 

.2 
o 

CD 
U 

d 

CD 
CO 

CD sp 

Oh *d" 

2 d 

d *o 
.a cd 

< ^ 

" o 

CO 

CD 



CD 

d 

c3 
+-> 

C 



Cm 

O 

O 



C3 
O 

'-5 
S 

CD 

o 

CO 

CD 

ca 



CD 

d 

_o 

3 

CN 

_ x> 
2 U 

d i> 
.2 "d 



u 

> 
• ^^ 
+-» 

CD 

CD 

CO 

CD 
Ih 



CD 
d 

| 

S-H 

CD 



CO 



d 

s * e N y +J 



-d 



d 
3 



o 

'-^ 

2 

o 

3 

-2 



^•3 



00 

CC! 
i 

C3 



3 -^ 



OO 



O 
o 



d 

C3 

d 



CO 

d ., 
O £ 



c3 

£ 

c 

3 
ej 

CL, 



CD 

d 

C3 



ed 

CD 

H 

CO 

d 



CO 

o 

3 

-a 
o 



CD 
4— < 

d 

a 

CD 

bfl 

ca 

E 



_g 

'o 

• 1—1 

"a, 

CO 

C+H 

O 



d 

CD 



2 ? 
Cm d 

d 

cd 



S o . 

° *S x 

d & u 

ft O CD 

5P d 
d »H 



< 



CO 

d 



5 co .a 



2 & -2 5 .2 13 
s -o 2 2 2 2 

•"• g J5 ^ VH (H 



■a ft 

S -d 

•5 u 

ft &^ 



d 

cd 

oo 

CN 

ed 

t> 

^3 

3 

d 
_o 

'■*-» 

jj 

o 

-a 



CXj 

d 

■ *H 

d 

o 

Ch 
CO 

CD 

b 

o 
o 



87 



u 

•F-H 




i : zz; 


-M 






ta 






B 

o 


J 

« 


1=81 




£ 

j 


r-6 




& 




Oh 






H 




i:8'l 
: l 

_ i:6 






V9 


£ 


So" 




.2 


CM 






a 

r3 


V£ 


oj 


ts 




Q 


rH 


i:9"0 
0=1 


(auop? im) 1=0 




CM 




&H 




Xi 






u 




I 



88 



g 



03 



O 



H 



O 



^*.' 'i',' '*,'■'* 



p . t ■ . » J. I ■ . 1 ■ j ^ ■ 



pig 



sfif&Si 



K'.< ■!• '.• *.• ■.- '.• 'iv 
■■ v. ' y. ' .' ' *. * . r ' ' ^* 7 .".' ' . * ' .'^ 



^•* • •' i * •'•' i •* i '*•'.'' 



5 



k- ' .'• ' .'■ ' .'• ' .'-I'- .'• .• ' ■'• .'■ ■'•. ' •'•. ' .'•J. 1 -. •'-.•'■. ' ■'■■ ' •'•. ■'■. ' •'•.•'•.-'•■-'■■ ' ■••■ ' • i, . X 



«fc 



*S ■ > ' .' "S ■ N S ~ 



o 
o 



o 

00 



(N 



oo 



On 



00 



O 

35 



o 



o 
IN 



Oh 

6 

i 






1 



5 
u 

3 



pa 



00 

(N 

i 
IN. 

C 

o 

•H 

p 




tin 



Supxjds % 



89 
inhibition observed in this experiment was a function of total protein concentration 

(mutant + wild-type Cbp2), rather than being a property of mutants. To test this 
possibility, splicing was performed with increasing concentrations of wild-type 
Cbp2 alone (Figures 4-9A and 4-9B). Maximum splicing activity was obtained at 
a protein:RNA ratio of 7:1 (lane 4 in Figure 4-9A; expressed as 100% activity in 
Figure 4-9B). However, splicing was severely inhibited at 28:1 (lane 6), and 
almost completely inhibited at higher ratios (lanes 7 and 8) of wild-type 
Cbp2:RNA. The splicing levels dropped to 21% (for 28:1) and -1% (for 56:1 and 
1 12:1) of the activity obtained at 7:1 ratio (Figure 4-9B). Thus, wild-type Cbp2 
appears to stimulate splicing only in a narrow range of protein :RNA ratios, with 
higher levels being inhibitory. In order to determine whether aggregation was the 
cause for the observed inhibition of activity, these experiments were repeated over 
a wide range of concentrations of wild-type Cbp2. Identical inhibition was 
observed whether the protein was titrated at lower (3.6-58 nM) or higher (up to 
1 16 nM) ranges, suggesting that aggregation of protein was not a problem in these 
experiments (data not shown). 

It is possible that the observed inhibition of splicing at higher concentrations of 
wild-type protein could be due to non-specific interactions of Cbp2 (a highly basic 
protein) with its RNA counterpart. This possibility was tested using the non- 
specific competitor, tRNA, in partially inhibited splicing reactions. A titration of 
Cbp2 concentration in the absence of tRNA is shown in Figures 4-10A (lanes 1 to 
6) and 4-10B (left panel). The maximal splicing observed at 14:1 ratio (lane 3, 



Figure 4-9. Effect of increasing concentrations of wild-type Cbp2 on protein- 
mediated splicing. Radiolabeled intron 5 RNA was pre-incubated with increasing 
concentrations of wild-type Cbp2 for 10 min at 37°C. Splicing was initiated by the 
addition of0.2mMGTP and incubation continued at 37"C for 30 min. Spliced 
products were resolved on 4% polyactylamide-8M urea gels and autoradiographed. 
A. Lane 1, intron 5 RNA alone; lane 2, splicing at protein:RNA of 1:1; lane 3, 
3.5:1; lane 4, 7:1; lane 5, 14:1; lane 6, 28:1; lane 7, 56:1; and lane 8, 112:1. B. 
Phosphorlmager quantitation of the gel shown in A was used to plot the % splicing 
(ratio of the sum of ligated exons and 5' exon to unspliced precursor) as a function 
of wild type-Cbp2 to RNA ratios, setting the extent of splicing obtained at 7:1 to 
100%. 



91 



A. 



Cbp2 : RNA 




12 3 4 5 6 7 8 



92 



B. 



100 



bO 



(X 

CD 




1:1 3.5:1 7:1 14:1 28:1 56:1 112:1 

Wt-Cbp2:RNA 



Figure 4-9. . .continued 



a § b ! 

a, ■*-' T5 o 

H— I ^ 

£ 8 W > 

co m g 

KS i <u 

8 a I « 
J- £ Z s 

£ cj ,3 .B 



r- 

M-l 

o 

o 



< 



'h-h 

o 

u 
o 

E3 
u 

< 2 

^ -S 

o •» 

*"• o 
b \s 



u 



KJ 



^ O DO 
<— " 03 -rt • • 

fl S S o 

-I o, a "^ 

6 ^ H < 

„ 3 © .g 
2 I 2 



u 



'-& S 52 £ 



2 < 
b* z 



o 

c 



c3 
(2 



o § 



i q »_, 03 

I § ss 

a'O SP fa 
».S .9 £ 

13 52 3 U 

£ o iS 

l -< u u 

S"Z c c 

•B J3> <U '& 
r ) I- 1 -! co r- 

^ O S § 

S-S » 52 

-P <U -G § 
-2 v-i c B 

•r Oh-~ o 

p oo *n *5 

c B On g 
O -S <N •§ 



03 Ph 

oc _g 
.1 o 



Oh 


CX 


»1 






1 1 


<N 


o 


U 


CN 


c 


♦-J 


r^ 


BS 






. r 


GJj 



o 

§ - 1 -' Tf 

JS -O 2 cd 

•73 § * u 

6» C3 .5 -P 

- ■* S ^ § 



o j=, 



2 «w « 



o 



c 



l-H 

c 
u 

o 

c 
c 
a 



2 ^ 73 « -B < 



CO 



60 



2 6 



J3 



bO 

C 



en 

u 

c 



CN 



° w S 

o fa ^ 



u o 



o 

O d 6 

•- o o •-* 

.- S -j3 T3 

"2 « ^ rt 

55 CN < P^ 

t CO 

' *0 « (d 

Kb 1 3 ej M 

•SP o a 5 



JC3 ^. 

Oh ^h 

bb^> 

O 1) 

^ 1 

l-H 



3 



a 3 



b Oh 

&J2 



73 O-q 

"£h pQ ^u Z 

Oh 



■b T; <a 



co 
in 



in 



< 



V 

c 
3 



CO " 

B (N 

3 Oh 



5 



U 

, B 

lU 03 

3 






B 
, O 

73 U 
(M bO "1 ^3 

° E -9 ^ 

c O co 



o s 



u 

B 



a <n s -s 



Oh 

u 

J3 



(U o 



CU "O 



B 



c 
,3 



£• r »-h 



O -T 

cd fl 

>-^ <u 

O § 



^ 52 B 



u en 

03 C3 

— bO 

_ .— CO 
C "^ 03 

^5 II 



3 2 » Oh 

^d o .52 



o 
B 
Ed 

Oh 

4-h 

b/j 



94 





H 


-M 




fti 


Os 


^^ 


CN 




MH 


b 


O 


>s. 


< 


fcj 




£ 


t3 




' 


< 


(N 


^y 


Oh 


-w 


6 



el 



Z"0 






8X0 


■ 1 




9X0 


( il 




no 


I l 






3X0 








XO 











1 1 




X=9XX 






X - -8S 


« 




V6Z 


1 




X^X 


. i 


i 


VL 


n 


I 


1=0 






I 



D 



c<"> 



00 

in 
<* 

CO 



95 




6 



T3 
% 



3 
o 

4 



CQ 




Uh 



Supijds % 



96 

Figure 4-10A) of Cbp2 to RNA was set to 100% (Figure 4-1 OB). Similar to the 

results reported above (Figures 4-9A and 4-9B), a protein:RNA ratio of 29:1 
lowered splicing to -40% of that at 14:1, with almost complete inhibition at higher 
ratios (Figure 4-10B, left panel). Addition of increasing concentrations of tRNA 
to splicing reactions containing protein:RNA ratio of 29:1 (partially inhibited 
reactions) restored splicing activity to the levels obtained at 14:1 ratio (Figure 4- 
10A, lanes 7-13; right panel in Figure 4-1 OB). It is interesting to note that the 
addition of just 10 ug/ml tRNA resulted in a marked rescue of splicing activity. 
These results suggest that tRNA overcomes the inhibition of splicing by reducing 
non-specific interactions of Cbp2, allowing the formation of splicing-competent 
protein-RNA complexes. 

In light of the above results, the inhibition of wild-type Cbp2-mediated splicing 
by deletion and triple aromatic mutants was re-examined under conditions that 
minimize non-specific protein-RNA interactions. Keeping the wild-type 
Cbp2:RNA ratio at 1:1, the concentrations of deletion and triple aromatic mutant 
proteins were increased such that the total protein (wild-type + mutant Cbp2) to 
RNA ratios did not exceed 7:1 (Figures 4-1 1A). Figure 4-1 IB shows the splicing 
activity under these conditions as a function of mutant to wild-type Cbp2 ratios. 
Neither mutant inhibited wild-type Cbp2-mediated splicing at the mutant:wild-type 
Cbp2 ratios tested (Figure 4-1 IB). These results clearly show that the inhibition of 
splicing by higher concentrations of Cbp2 (wild-type or mutant) was a function of 
total protein to RNA ratios and not a characteristic of the mutants per se. 



Figure 4-11. Effect of mutant proteins on wild-type Cbp2-mediated splicing 
at low total protein to RNA ratios. A. Radiolabeled intron 5 RNA was pre- 
incubated for 10 min at 37°C with a constant amount of wild-type Cbp2 and 
increasing concentrations of deletion (aal7-aa28) or triple aromatic mutants, such 
that total protein to RNA ratios did not exceed 7 to 1 . Splicing was initiated with 
0.2 mM GTP, products resolved on 4% polyacrylamid-8M urea gels, and 
autoradiographed. A RNA alone (lanes 1 and 9); splicing in the presence of wild- 
type Cbp2 alone (lanes 2 and 10); splicing in the presence of a constant amount of 
wild-type Cbp2 + increasing concentrations of deletion (aal7-aa28) mutant (lanes 
3-8) or triple aromatic mutant (lanes 11-16). The ratio of mutant to wild-type 
Cbp2 in each reaction is indicated above the lanes. The precursor RNA and 
spliced products are schematically represented on the left of the gel. B. 
Quantitation of the gel shown in A was used to plot the splicing ratio (sum of 
ligated exons and 5' exon to unspliced precursor) as a function of mutant: wild-type 
Cbp2 ratio. 



98 



A. 



Deletion (aal7-aa28) 



Triple aromatic (RLRLKL) 



Mutant : Wt 06 «h (n m -* in >ii 



oot-hcn co-^ mvo 




12 3 4 5 6 7 



9 10 11 12 13 14 15 16 



99 



B. 



0.10- 



0.08- 



"5 0.06 ■ 
M 

S 

u 
5 0.04 ■ 

Oh 

en 



0.02 



Q Deletion (aal 7-28) 

B Triple aromatic mutant 



0.00' 





0:1 1:1 2:1 3:1 4:1 5:1 6:1 

Mutant:Wt-Cbp2 



Figure 4-11.. .continued 



100 
Discussion 

UV-crosslinking studies (Chapter 3) showed a 37-amino acid N-terminal region 

to be in close proximity with intron 5 RNA under facilitated splicing conditions. 

These findings provided specific targets for mutagenesis, obviating the need for 

general surface scanning methods like alanine scanning (Cunningham and Wells, 

1989). A 12-amino acid stretch (aal7-SSSRYRYKFNME-aa28) in this 37 amino 

acid region was predicted to be critical for RNA-protein interactions, based on the 

biochemical properties of the residues. Therefore, this 12-amino acid region was 

targeted for individual or cluster mutagenesis to alter the surface properties of this 

region and study their effects on protein function. Deletion (aal7-aa28) and triple 

aromatic (Y21, Y23, and F25 to L) mutants were completely defective in splicing 

under low salt conditions, even at high protein concentrations (Figure 4-2). These 

data confirm the prediction that aal7-aa28 is a critical region essential for Cbp2 

function. However, it is important to show that these changes did not alter the 

conformation and stability of mutant proteins. Unfortunately, Cbp2 has no known 

function other than facilitating the processing of intron 5 (McGraw and Tzagoloff, 

1983) and the co intron (Shaw and Lewin, 1997), unlike bi-functional RNA- 

binding proteins like the mitochondrial tyrosyl tRNA synthetase (Cytl8) of 

Neurospora crassa. Cytl8, in addition to its synthetase function, facilitates the 

splicing of several mitochondrial group I introns (Akins and Lambowitz, 1987). 

This bi-functionality of Cytl8 was exploited to demonstrate the native 

conformation of splicing-defective mutants by assays for synthetase function 



101 
(Cherniack et al, 1990). Since our system does not afford this luxury, the 

conformational integrity of the Cbp2 mutants was addressed using partial 
proteolysis and equilibrium RNA binding assays. 

Partial proteolysis is a simple and powerful tool to analyze the conformational 
states and domain structure of proteins. It is based on the principle that protease- 
susceptible sites often occur between independently folded domains. The potential 
cleavage sites within these domains are protected from proteases in the native state 
and exposed to various degrees in the denatured or partly unfolded states (Cleghon 
andKlessig, 1992; Parker et al., 1998). Partial proteolysis has been successfully 
used to study conformational changes in proteins induced by DNA binding (Chang 
and Doi, 1993; Hay and Nicholson, 1993; Petersen et al, 1995; Ikeda et al, 1996) 
or binding to a specific ligand (Vaisanen et al, 1997; Modarress et al, 1997; Chu 
et al, 1997). This approach was also used to compare the conformation of wild- 
type and mutant proteins in mutagenesis experiments to detect structural 
perturbations, if any, caused by the mutations. For instance, Liu et al (1996) 
compared the folding patterns of several rhodopsin point mutants by partial tryptic 
digests and CD spectroscopy. They found that changes in protein conformation 
between wild-type and mutant proteins indicated by partial proteolysis were in 
good agreement with the results of CD spectroscopy. Therefore, we utilized 
partial proteolysis to probe the conformational states of wild-type and mutant Cbp2 
proteins. The partial proteolytic profiles obtained with mutant Cbp2 proteins were 
similar to that of the native but not the heat-denatured Cbp2 (Figure 4-3). These 



102 
results suggest that the deletion and triple aromatic mutants possess a 

conformation similar to that of wild-type protein and yet lack some of the key 
amino acid residues essential for Cbp2 function. 

The formation of a functional Cbp2-intron 5 RNA complex requires proper 
folding of RNA and an intact native conformation of protein. Filter-binding assays 
with deletion and triple aromatic mutants exhibited hyperbolic RNA binding 
patterns similar to that of wild-type Cbp2 (Figure 4-6B). Although the mutants 
varied in their affinity for RNA (ka measurements in Table 4-3), their identical 
binding profiles suggest that these proteins have a wild-type-like conformation that 
allows interaction with cognate RNA (intron 5 RNA). However, as discussed 
above, these two mutants did not promote splicing of intron 5 RNA under low salt 
conditions. Together, these data suggest that the RNA binding property of Cbp2 
(as detected by the filter binding assay) can be separated from its splicing- 
enhancement function (as evidenced by the absence of spliced products under low 
salt conditions). They also suggest that the RNA binding ability may not be 
sufficient by itself to promote splicing at physiological concentrations of Mg 2+ 
(employed in these experiments). The protein-RNA complex may have to attain a 
particular active conformation (through specific contacts) before splicing can be 
initiated. The salient features of the residues in aal7-aa28 region may enable this 
function. 

In order to pinpoint the essentiality of individual residues in the aal7-aa28 
region, a series of point mutations were made and characterized in vitro. Analysis 



103 
of these mutant proteins again emphasized the importance of the aromatic and 

charged residues in this region. The triple charged mutant (R20, R22, K24 to L) 

yielded a protein with partial activity in splicing assays (Figures 4-4 and 4-5), in 

contrast to the triple aromatic mutant (Y21, Y23, and F25 to L), which was 

completely defective in splicing (Figure 4-2). Therefore, the charged residues at 

positions 20, 22 and 24 are important for Cbp2 function, though not as critical as 

the aromatic residues at positions 21, 23, and 25. 

Single mutations changing each aromatic residue to leucine gave contrasting 

results. The Y21L mutant gave very low partial activity (with initial rates of 

splicing lowered by 45-fold compared to wild-type, Table 4-2) while the F25L 

mutant behaved almost like wild-type Cbp2 in the splicing time course 

experiments (Figures 4-4 and 4-5). In addition, the Y21L and triple charged 

mutations appear to have affected the first step of splicing, since the splicing 

intermediates (5' exon and intron-3' exon) are markedly diminished compared to 

the spliced products (ligated exons and free intron) (Figure 4-4B). 

It is important to note that a single substitution in the case of the Y21L mutant 

lowered the rate of splicing comparable to the triple charged mutant (40-fold 

reduction, Table 4-2), emphasizing the indispensability of this tyrosine residue at 

position 21 for splicing enhancement function. The importance of the Y21 residue 

is also highlighted by the fact that the tyrosine to leucine change at this position 

alone made a significant impact on the kd. A 5 -fold increase in kd is quite 

significant for a single amino acid change in this elongated protein of 630 amino 



104 
acids. The partial activity of Y21L could be due to the presence of the other 

important residues in the aal7-aa28 region, partial compensation by the C-terminal 
RNA binding domain, or both. 

Cbp2 is reminiscent of proteins containing the double stranded RNA binding 
motif (DSRM or dsRBM). DSRM is a conserved 65-68 amino acid region with 
basic and hydrophobic residues scattered throughout the motif (St. Johnston et al, 
1992;Green and Mathews, 1992 and McCormack et al., 1992). A recent search 
has identified about 44 dsRBM sequences from 27 functionally diverse proteins 
(Kharrat et al, 1995). Mutational analysis indicates that nearly all of the 
conserved residues are important for double-stranded RNA binding (Gatignol et 
al, 1993, Gatignol et al, 1991). The DSRM motifs occur in single or multiple 
copies in a protein and specifically bind double-stranded RNA in a sequence- 
independent manner (Hunter et al, 1975). Studies on the human dsRNA- 
dependent protein kinase, PKR, indicate that the specificity for dsRNA is largely 
due to non-electrostatic interactions with a network of 2' -OH groups on both 
strands of RNA (Bevilacqua and Cech, 1996). At physiological salt 
concentrations, 90% of the free energy of binding is non-electrostatic owing to a 
single ionic contact between K60, a conserved amino acid of DSRM, and the 
phosphate backbone. Hydroxyl-radical footprinting experiments with PKR 
indicate that the dsRBD interacts directly with the minor groove of dsRNA. 
Minor-groove recognition has also been reported in the binding of tRNA Ala by its 
aminoacyl-tRNA synthetase protein (Musier-Forsyth and Schimmel, 1992). Cbp2 



105 
has hydrophobic and basic residues scattered throughout the length of the protein. 

Hence, it is likely that different regions of this protein may participate in 

sequence-independent recognition of the conserved intron structure, in addition to 

engaging in specific interactions with the bases. Experiments with the triple 

charged mutant of Cbp2 indicate that the charged residues are important but not 

absolutely essential for activity, suggesting that these residues may not form 

specific ion pairs with the phosphates of RNA. It is possible that Cbp2 might be 

involved in a variety of non-specific interactions with the sugar-phosphate 

backbone of intron 5 RNA. These might include non-electrostatic interactions 

with 2' -OH groups of sugar residues or functional groups of bases. 

Another motif that shares a few similarities with Cbp2 is the arginine-rich motif 

(ARM) found in several viral, bacteriophage and ribosomal RNA-binding proteins. 

There is very little identity between ARM sequences of different RNA-binding 

proteins other than the preponderance of arginine residues (Lazinski et al., 1989). 

For instance, the ARM regions of two HIV RNA-binding proteins, Tat and Rev are 

dissimilar. Peptides containing the Rev ARM specifically bind RRE (Rev 

responsive element) as an alpha helix (Tan et al., 1993) while Tat ARM peptides 

are largely unstructured, but adopt a stable conformation upon binding the TAR 

sequence (Calnan et al., 1991). Amino acids outside the conserved ARM regions 

are important for in vitro RNA binding by Rev and Tat (Tan et al, 1993), as well 

as for wild-type activity of other ARM proteins (Lazinski et al., 1989). Thus, the 

overall structure of the ARM protein is important for RNA binding. Two general 



106 
roles have been attributed to the arginine residues of ARM proteins. The positive 

charge of arginine may increase non-specific affinity for RNA, thereby facilitating 

the search for high-affinity binding sites. A second role could be in the formation 

of specific hydrogen bonds with the phosphoribose backbone and bases of RNA. 

As two of the three basic residues in the putative N-terminal RNA binding region 

(aal7-aa28) of Cbp2 are arginine residues, one or both of the above mentioned 

roles may be important for Cbp2-RNA interactions. However, the partial splicing 

activity of the triple charged mutant suggests that the net positive charge on Cbp2 

may serve to bring the RNA molecule closer (by non-specific interactions), 

allowing the search for specific, high affinity sites associated with other functional 

groups on the protein. In addition, regions outside independent RNA-binding 

domains may also contribute to total RNA binding (analogous to the ARM 

proteins), as basic residues are scattered throughout the length of Cbp2. 

The tyrosine residue at position 21 in Cbp2 appears to be indispensable for 

activity, pointing to several possible roles in the stabilization of protein-RNA 

interactions. The polar nature of the residue would allow polar interactions with 

the phosphate backbone/bases of RNA, while the aromatic property would allow 

stacking interactions with the bases. However, polar interactions may play a key 

role in this context as additional polar amino acids such as serine (3 residues) and 

asparagine flank this residue. The aromatic property, if essential, may be limited 

to position 21, as phenylalanine (another aromatic residue) at position 25 is 

dispensable for activity. The importance of having a polar/nonpolar, aromatic 



107 
residue at position 21 could be addressed by substitution with phenylalanine 

(Y21F). A reduction in activity would suggest the existence of a polar interaction, 
while no effect would argue for a stacking role of the Y 2 i residue. If this mutant 
(Y21F) has the former phenotype, substitution of F 2 i with a polar residue like 
serine or threonine should restore activity, proving the importance of a polar 
residue at position 21. The importance of both polar and stacking interactions in 
protein-RNA complexes has been documented in several systems. For instance, 
crystal structure of the RNA bacteriophage MS2 coat protein complexed with its 
RNA substrate (19-nucleotide stem-loop structure containing the initiation codon 
of the replicase gene) shows that about 7 phosphates are involved in 1 1 
interactions with the protein (Valegard et al, 1994). Of these, six are polar 
interactions involving asparagine, serine or tyrosine, while a conserved tyrosine at 
position 85 of MS2 protein (A subunit) is involved in stacking interactions with 
the bases of RNA. 

An offshoot of the mutational analyses has been an insight into the types of 
interactions between Cbp2 and intron 5 RNA. Splicing experiments with 
increasing concentrations of wild-type Cbp2 indicated that higher ratios of protein 
to RNA were inhibitory (Figure 4-9). A similar inhibition was observed with the 
deletion and triple aromatic mutants at total protein (wild-type + mutant) to RNA 
ratios of 29:1 or above (Figure 4-8). Also, when the ratio of total Cbp2 (wild-type 
+ mutant) to RNA was kept at or below 7:1, there was no inhibition of wild-type- 
mediated splicing (Figure 4-1 1) by these mutant proteins. These results indicate 



108 
that the observed inhibition was not a property of the mutant proteins, but a 

function of the ratio of total Cbp2 to RNA. It is important to note that the protein 

to RNA ratios (below 30:1) that stimulated splicing corresponded to the linear 

range of RNA binding profiles measured by filter binding assays (Figure 4-6B). 

Thus, Cbp2 concentrations corresponding to submaximal RNA binding appear to 

be important for specific, productive interactions between RNA and protein. 

RNA-binding proteins, such as Cyt-18 of Neurospora crassa, have been 
observed to engage in non-specific interactions with RNA in vitro (Saldanha et ah, 
1996). These non-specific interactions were reduced by the addition of an RNA 
mimetic like heparin. In order to test if the inhibitory effects of higher Cbp2 
concentrations could also be overcome by a non-specific competitor, splicing 
experiments were performed with wild-type protein at an inhibitory ratio of 29:1, 
but in the presence of excess tRNA. Splicing activity was almost completely 
rescued with the addition of tRNA (Figures 4-10A and 4-1 OB), demonstrating that 
counteracting the non-specific interactions could alleviate the inhibition of 
splicing. 

There are at least two instances in the literature where similar phenomena were 
observed. Nucleocapsid protein (NC) of HIV- 1, a non-specific RNA-binding 
protein, enhances the activity of a hammerhead ribozyme (HH16) in vitro only in a 
narrow range of protein concentrations (Herschlag et al., 1994). The observed rate 
constant for single turnover reactions showed an increase followed by a decrease 
with increasing NC protein concentration. Protein concentrations higher than that 



109 
required for stimulating multiple turnover decreased the rate of reaction. Though 

the trends observed were reproducible, the exact concentration of NC protein 

required for stimulation and inhibition varied with the experiment. Addition of 

intermediate concentrations of the non-specific competitor, ssDNA, to reactions 

containing an inhibitory NC concentration stimulated multiple turnover. Further 

experiments demonstrated that NC protein, at higher concentrations, shuts down 

RNA function by binding to the ribozyme-substrate complex and blocking the 

cleavage step. Thus, high concentrations of NC protein appear to bind more 

strongly to the denatured or inactive rather than the active conformation of the 

hammerhead catalytic core. 

The hnRNP proteins such as hnRNPAl, CI, and U have been shown to 
promote annealing between complementary single strands of RNA in vitro (Kumar 
and Wilson, 1990; Portman and Dreyfuss, 1994). Interestingly, the RNA 
annealing activity is reduced or abolished at high protein:RNA ratios (Munroe and 
Dong, 1992; Portman and Dreyfuss, 1994). Portman and Dreyfuss (1994) 
proposed that excess protein may inhibit annealing by stabilizing the single 
strands, sterically blocking RNA base-pairing and/or squelching sites required for 
protein-protein interactions involved in RNA annealing. 

Analogous to the above systems, it is possible that Cbp2, at high protein to 
RNA ratios, shuts down splicing by binding to alternate sites on intron 5 RNA and 
stabilizing an inactive conformation. However, in the range of protein 
concentrations that stimulate splicing (protein:RNA ratios of 14:1 or below), this 



110 

non-specific RNA binding may be necessary to promote the formation of the active 

intron structure and facilitate splicing. Thus, Cbp2 appears to engage in both non- 
specific and specific interactions with intron 5 RNA. UV-crosslinking monitors 
the interaction between closely apposed functional groups in RNP complexes, with 
the extent of crosslinking representing the extent of specific interactions. Filter 
binding analysis, on the other hand, determines the general RNA binding profiles 
of proteins, emphasizing the non-specific interactions. 

Certain mutations in the N-terminal crosslink site of Cbp2 (first 37 residues) 
not only affected splicing but also lowered the extent of crosslinking to intron 5 
RNA. For instance, triple charged and Y21L mutant Cbp2 proteins with partial 
splicing activity showed low levels of crosslinking (Figure 4-7). Thus, the 
crosslink sites on Cbp2 appear to reflect productive interactions in the RNP 
complex that lead to correct folding and splicing of intron 5 RNA. Shaw and 
Lewin (1995) have identified the nucleotides of intron 5 RNA that crosslink to 
Cbp2 at protein:RNA ratios that promote splicing. These include specific 
pyrimidine residues in the catalytic core (P4-P6, P3-P7) and in the peripheral 
domains (P2) of the secondary structure. Mutagenesis of some of these crosslink 
sites in intron 5 RNA also affected protein-mediated splicing (Shaw and Lewin, 
unpublished observations), suggesting again that crosslink sites represent specific 
contact sites important for catalysis. 

At protein:RNA ratios that promote splicing, non-specific interactions may 
precede the formation of specific contacts between Cbp2 and intron 5 RNA that 



Ill 

lead to catalysis. At high protein concentrations, however, non-specific 
interactions may predominate and preclude the formation of specific contacts that 
are essential for promoting the catalytic conformation of RNA. It can be 
speculated that the charged residues on Cbp2 may, in part, be important for these 
initial, non-specific encounters, while aromatic residues (such as Y 2 i) may be 
involved in making specific contacts with intron 5 RNA. 

In summary, UV-crosslinking and site-directed mutagenesis has identified a 12 
amino acid (aal7-SSSRYRYKFNME-aa28) region in the N-terminus of Cbp2 to 
be very critical for Cbp2 function. It is interesting to note that the first 44 N- 
terminal amino acid residues of Cbp2 in S. cerevisiae and S. douglasii are identical 
(Li et al, 1996) and are typical of mitochondrial matrix targeting sequences, being 
rich in hydroxylated and basic residues with a few acidic residues (von Heijne, 
1986). However, the presequence of Cbp2 is not cleaved after import into S. 
cerevisiae mitochondria (Lewin, unpublished observations). It is tempting to 
speculate that the indispensability of the N-terminal residues for Cbp2 function 
could have been the evolutionary rationale for retainment of the mitochondrial 
presequence after import. We have not determined, however, if the mitochondrial 
targeting sequence of Cbp2 lies in this region. 



CHAPTER 5 
SUMMARY AND PERSPECTIVES 

Biological processes such as RNA splicing, RNA processing, and translation 
require the interplay between RNA and proteins. There is substantial evidence that 
the essential active site structures for these ribonucleoprotein (RNP) enzymes are 
provided by the folded RNA itself (Guerrier Takada et al, 1983; Madhani and 
Guthrie, 1992; Myers et al, 1996; Noller et al, 1992). The protein component of 
these RNPs may facilitate RNA catalysis by stabilizing the active RNA structure 
(Saldanha et al, 1996; Shaw and Lewin, 1995; Weeks and Cech, 1996), increasing 
affinity for substrate (Kurz et al, 1998), or regulating activity of the RNP complex 
(Mogridge et al., 1998). Although many group I introns have been shown to self- 
splice in vitro, most, if not all, require protein factors for efficient splicing in vivo. 
Self-splicing in vitro requires unusually high Mg 2+ concentrations for optimal 
activity (Hicke et ai, 1989; Jaeger et ai, 1991; Partono and Lewin, 1988, Partono 
and Lewin, 1991), and involves complex reaction kinetics that often result in lower 
reaction rates (Bass and Cech, 1984; van der Horst and Tabak, 1985; Pan et ai, 
1997). The self splicing rate of the prototypic Tetrahymena ribozyme, for 
example, is 20 times lower at physiological Mg 2+ concentrations in vitro compared 
to that in vivo (Brehm and Cech, 1983), suggesting the requirement of protein co- 
factors for efficient splicing in the cell. 

112 



113 
The Cbp2-intron 5 RNP complex of Saccharomyces cerevisiae represents a 

simple but valuable one protein-one RNA system to gain insights into RNA- 

protein interactions. The RNA component (intron 5) is the terminal intron of the 

mitochondrial cytochrome b (COB) pre-mRNA, while the protein component 

(Cbp2) is nucleus-encoded and is essential for the splicing of intron 5 in vivo (Hill 

et al, 1985; McGraw and Tzagoloff, 1983), or at physiological magnesium 

concentrations in vitro (Gampel et al., 1989; Lewin et al., 1995; Weeks and Cech, 

1995). 

The current study represents the first attempt at mapping intron 5 RNA binding 
sites on Cbp2. The UV-crosslinking strategy of Zamore and Green (1989) was 
employed to map the amino acid residues on Cbp2 that intimately contact intron 5 
RNA. Briefly, protein-RNA complexes generated under low salt splicing 
conditions were immobilized with UV light and the crosslink sites on Cbp2 were 
identified by indirect label transfer to peptides generated by two cleavage reagents, 
hydroxylamine (NH2OH) and 2-nitro-5-thiocyanobenzoate (NTCB). 

Hydroxylamine was the ideal reagent to obtain an initial handle on Cbp2 sites 
contacting intron 5 RNA, since it is specific to the relatively infrequent 
asparaginyl-glycyl peptide bond (Bornstein and Balian, 1977) and yields fewer 
peptide fragments. Strong crosslink sites mapped to a 24 kDa N-terminal peptide 
(aal-179aa) and a 15 kDa C-terminal fragment (aa5 02-63 Oaa), showing that the 
termini of Cbp2 comprise important RNA binding domains. However, the 37 kDa 
central fragment (aal 80-50 laa) displayed very weak crosslinking. The central 



114 
region may be comprised of weaker binding sites that may be important for the 

overall stabilization of the RNP complex. The importance of such weak RNA 

binding domains in protein-RNA interactions is exemplified by the glutaminyl- 

tRNA synthetase of Saccharomyces cerevisiae. This protein carries a novel and 

dispensable N-terminal domain in addition to its active RNA binding site, which is 

closely homologous to its Eschericia coli counterpart. Although the bacterial 

synthetase is not capable of charging yeast tRNA elu , addition of the appended 

domain of the yeast protein confers specificity to yeast tRNA 8 u (Whelihan and 

Schimmel, 1997). This suggests that the appended domain may engage in an 

additional RNA interaction that compensates for poor complex-formation by the 

native bacterial enzyme. In eukaryotes, such appended domains are common in 

these proteins and may serve to overcome conditions that would otherwise weaken 

or disrupt the formation of a critical RNA-protein complex (Whelihan and 

Schimmel, 1997). 

In order to refine the mapping of the crosslink sites identified in the terminal 

fragments, 2-nitro-5-thiocyanobenzoate (NTCB), specific to cysteines (Jacobson et 

al, 1973; Degani and Patchornik, 1974), was employed as cleavage with this 

reagent generates several peptides within the termini of Cbp2. The availability of 

his-tagged and native versions of Cbp2 was exploited to unambiguously map the 

N-terminal contact site to the first 37 amino acid residues of Cbp2 by NTCB 

cleavage (Figure 3-3). The C-terminal contact site was tentatively mapped to a 

region spanning aa502-582aa, as the extreme C-terminal fragment failed to 



115 
crosslink intron 5 RNA. Attempts to pinpoint the RNA contact sites in this 80 

amino acid-region were not successful as the peptides generated by a combination 

of NH 2 OH and cyanogen bromide were too small to be resolved by the tris-tricine 

gel system. The use of HPLC or mass spectrometry to resolve these smaller 

crosslinked peptides will alleviate this problem and lead to the identification of the 

specific C-terminal residues that crosslink to intron 5 RNA. Thus, the results of 

the study have led to the identification of key amino acid residues in the N- 

terminus that are critical for Cbp2 function. Fine structure mapping of these RNA 

contact sites using other cleavage reagents will eventually lead to a better 

understanding of the mechanisms underlying Cbp2-intron 5 RNA interactions. 

It is interesting to note that the two strong RNA contact sites identified by UV- 

crosslinking (current study) are distally located at the N- and C-termini of Cbp2. It 

is possible that these terminal regions contact important elements of the intron that 

are widely separated in the secondary structure and stabilize the active intron 

structure. This, in fact, seems to be the case. Chemical modification and UV- 

crosslinking studies of the Cbp2-intron 5 RNA complex show that Cbp2 makes 

intimate contacts in multiple regions of the RNA such as PI, L2, P4, and P6a of 

intron 5 RNA (Shaw and Lewin, 1995). In addition, Cbp2 appears to bind across 

P8, sandwiching P1-P2 between P8 and the rest of the core (Weeks and Cech, 

1995). Thus, Cbp2 protein appears to bind one face of intron 5 RNA with an 

estimated distance of 90A between the protected regions. This distance, in theory, 

can be readily spanned by the 630aa-long Cbp2 protein (Weeks and Cech, 1995b). 



116 
The importance of N-terminal residues (aal-37aa identified by UV- 

crosslinking) for Cbp2 function was further investigated by site-directed 

mutagenesis. A potential RNA binding region (aal7-SSSRYRYKFNME-aa28), 

identified by physical scanning of the first 37 residues of Cbp2, was targeted for 

single and cluster mutagenesis. Deletion of this 12 amino acid region (aal7-aa28) 

in the N-terminus produced a mutant protein that failed to exhibit any detectable 

splicing activity but retained a near native conformation (as confirmed by partial 

tryptic profiles). This demonstrated that the 12-amino acid region (aal7- 

SSSRYRYKFNME-aa28) in the N-terminus was indispensable for Cbp2 function. 

The 12 amino acid-long RNA contact site identified by deletion analysis was 

probed further to evaluate the importance of individual amino acid residues for 

Cbp2-RNA interactions. This RNA binding region contains three aromatic 

residues that alternate with three charged residues. It was hypothesized that 

removing the aromatic residues would have more drastic effects on Cbp2 function 

compared to charged residues, as the former often engage in contacts that are more 

intimate with RNA by stacking with the bases. A triple aromatic mutant (Y21, Y23, 

and F25 to leucine) and a triple charged mutant (R20, R22 and K24 to leucine) were 

constructed to test this hypothesis. Leucine was chosen to substitute these residues 

because of similar chain lengths. This would allow surface properties to be altered 

with minimal perturbation of the topology of mutant proteins. As expected, the 

triple aromatic mutant completely abrogated Cbp2 function, while the triple 

charged mutant displayed partial activity with an initial rate of splicing ~40-fold 



117 
lower than that of wild-type protein. Since the triple aromatic mutant was 

completely defective in splicing, the aromatic residues Y21, Y23, and F25 were 

independently substituted with leucine to evaluate the contribution of each residue 

for Cbp2 function. The single mutation changing Y21 to leucine lowered the 

splicing rate by ~45-fold compared to wild-type Cbp2 (similar to the triple charged 

mutant). However, the mutation converting F25 to leucine did not affect splicing. 

The Y23L mutant could not be characterized due to repeated co-purification with 

nuclease activity. Thus, among the three aromatic residues, a tyrosine at position 

21 was found to be essential for Cbp2 function while a phenylalanine at position 

23 may be dispensable. 

In the time-course experiments with triple charged and Y21L mutants, a marked 

reduction in splicing intermediates (5' exon and intron-3' exon) was observed, 

suggesting that these mutations reduce the rate of the first step of splicing. Thus, 

guanosine binding or an important conformational step prior to the nucleophilic 

attack of guanosine at the 5' intron-exon boundary could be rate limiting for these 

mutants. Of these two possibilities, inefficient docking of PI in the catalytic core 

(conformational step) may be responsible for slowing the first step of splicing, as 

Cbp2 has been shown to promote this tertiary interaction in intron 5 RNA by 

dimethyl sulfate modification studies (Weeks and Cech, 1995). Similar studies of 

intron 5 RNA in the presence of either of these mutants can verify this hypothesis. 

If proven true, residues R20, R22, K24, and Y21 would be implicated in PI docking, 

an important tertiary interaction that precedes RNA splicing. 



118 



The panel of mutants described above was also characterized for RNA binding 
by equilibrium filter binding assays (Wong and Lohman, 1993). The general RNA 
binding profiles of all mutant proteins were more or less comparable to that of 
wild-type Cbp2, indicating little or no perturbation of the native conformation of 
these proteins. However, the dissociation constants of mutant proteins were found 
to be variable. For example, the Y21L mutant, with partial splicing activity, 
showed reduced RNA binding (5-fold increase in k<j), while the splicing defective 
deletion mutant showed tighter binding (~2-fold decrease in kd). Thus, there 
appears to be no correlation between the general RNA binding activity of mutants 
and their ability to support splicing. Therefore, general RNA binding ability (a 
common feature of both the wild-type and mutant proteins) may not be sufficient 
to stimulate splicing, while specific interactions between the active groups on 
Cbp2 and intron 5 RNA, which may be important for stimulation of catalysis, may 
not have a large impact on general binding. 

The generalized RNA binding activity exhibited by both mutant and wild-type 
proteins was characterized further by performing splicing assays at a wide range of 
protein to RNA ratios. Interestingly, wild-type Cbp2 was found to facilitate intron 
5 RNA splicing only in a narrow range of protein:RNA molar ratios (below 30:1). 
Splicing was stimulated when the protein:RNA ratio was increased from 1:1 
through 7:1 or 14:1, while ratios of 28:1 caused a 5-fold inhibition of splicing, 
with higher ratios being completely inhibitory. Addition of a non-specific 



119 
competitor such as tRNA to a partially inhibited reaction (at 29:1 ratios) 

completely alleviated this inhibition, suggesting that non-specific interations may 

predominate at higher protein concentrations, preventing the formation of a 

productive RNP complex. 

RNA has two fundamental folding problems: a tendency to become kinetically 
trapped in alternative conformations, and a difficulty in specifying a single tertiary 
structure that is thermodynamically favored over competing structures (Herschlag, 
1995). Non-specific RNA-binding proteins solve the kinetic problem by acting as 
RNA chaperones that either prevent misfolding or resolve misfolded RNA in vivo 
(Munroe and Dong, 1992). On the other hand, specific RNA-binding proteins 
overcome the thermodynamic folding problem by stabilizing a specific tertiary 
structure (Weeks and Cech, 1996). Such proteins can also have RNA chaperone- 
like activities (non-specific binding) that help prevent misfolding of their cognate 
RNAs (Herschlag, 1995). 

An investigation of Mg -dependent folding of the Tetrahymena ribozyme, 
revealed that this large RNA partitions into a population that rapidly reaches the 
native state and a slow-folding population that is trapped in metastable, misfolded 
structures. Transition from this misfolded to the native state involves partial 
unfolding. Thus, folding of large RNA molecules appears to involve multiple 
parallel pathways, with non-native intermediates dominating the folding kinetics 
(Pan et al., 1997). Hydroxyl radical footprinting of Tetrahymena ribozyme using a 
synchrotron x-ray beam enabled the study of RNA folding at millisecond intervals 



120 
(Sclavi et al, 1998). The study revealed that P4-P6, the most stable domain of the 

tertiary structure, folds within 3 seconds, while complete folding of the catalytic 

center takes minutes, suggesting that P3-P9 (another major domain of the catalytic 

core) remains disordered until late in the folding process. 

An alternate kinetic barrier to Mg 2+ -dependent folding of Tetrahymena 
ribozyme was concurrently proposed by Treiber et al. (1998). In vitro selection 
was employed to identify mutant ribozymes with accelerated folding of the P3-P7 
domain. Mutations that increased the rate of P3-P7 formation were found to 
destabilize the P4-P6 domain, suggesting that the latter may serve as a native 
kinetic trap in Tetrahymena ribozyme folding. The authors proposed that kinetic 
traps stabilized by native interactions, in addition to misfolded non-native 
structures, can present a substantial barrier to RNA folding. 

Analogous to the Tetrahymena ribozyme, the self-splicing of intron 5 RNA is 
not efficient. The rate of self-splicing is estimated to be 1000-fold slower than that 
of Cbp2-facilitated reaction at physiological pH and Mg 2+ concentrations (Weeks 
and Cech, 1995a). At saturating Mg 2+ concentrations (40 mM), self-splicing is 8- 
fold slower than the protein-facilitated reaction, suggesting that high Mg + 
concentrations cannot completely compensate for Cbp2 function. It was proposed 
that transition from an intermediate to the active enzyme state could pose a 
potential barrier for self-splicing. Subsequently, chemical modification studies by 
Weeks and Cech (1995b) indicated that the slow rate of self-splicing was due to 
the formation of a partially folded structural intermediate in which the catalytic 



121 
core was formed but the 5' domain (PI) was not docked. Based on these and other 

studies, it was proposed that Cbp2 facilitates splicing by assembling pre-formed 

RNA secondary structure elements into a specific three-dimensional array 

(formation of catalytic core and PI docking) (Weeks and Cech, 1995a; 1995b), and 

serves primarily to capture otherwise transient RNA tertiary structures (Weeks and 

Cech, 1996). However, Shaw and Lewin (1995), based on chemical and 

enzymatic modification studies, reported that Cbp2 facilitates the formation of 

secondary structures in addition to stimulating tertiary interactions. They also 

found that Cbp2 can nucleate the formation of the catalytic core in the absence of 

Mg 2+ by promoting duplex formation within P4/P6 and P1/P2, with Mg 2+ addition 

leading to rapid catalytic activation of this folding intermediate (Shaw and Lewin, 

manuscript in preparation). Thus, there are mechanistic gaps in our current 

understanding of the various roles attributed to Cbp2, making the global picture 

perplexing. The results of the current study provide interesting perspectives to 

accommodate the observed pleiotropic effects of Cbp2 on the processing of intron 

5 RNA, as discussed below. 

The E.coli S12 ribosomal protein facilitates proper folding of group I introns 

from bacteriophage T4 by nonspecific binding, suggesting a second mechanism for 

stimulation of group I intron splicing in vivo (Coetzee et al., 1994; Herschlag, 

1995). The S12 protein does not preferentially bind to group I introns over exons 

or other RNAs, indicating that splicing is facilitated by a nonspecific mode of 

action rather than by specific stabilization of the catalytic core. The protein can 



122 
also facilitate an unrelated reaction such as catalysis of a hammerhead ribozyme 

(HH16) (Coetzee et ai, 1994), similar to the two widely studied RNA chaperones, 
the nucleocapsid protein (NC) of HIV- 1 and the hnRNP Al protein. S 12 can also 
promote the splicing of kinetically trapped, inactive precursor RNA, suggesting an 
ability to resolve misfolded RNA structures analogous to RNA chaperones. 
Finally, S12 protein stimulates group I intron self-splicing even after removal by 
proteolysis prior to the initiation of splicing, further confirming that the protein is 
solely required for folding, similar to a protein chaperone that functions solely 
during a folding step and is not present in the final active species. 

The ability of S12 ribosomal protein to act as an RNA chaperone in the folding 
of group I introns in vitro raises the interesting possibility that a chaperone-like 
activity in specific RNA-binding proteins could also solve the kinetic problems of 
RNA folding. Based on this idea, Herschlag (1995) proposed that specific RNA- 
binding proteins could overcome the kinetic problems of RNA folding by 
following a "preassociation" binding mechanism. According to this, the protein 
initially engages in nonspecific and/ or a subset of specific interactions to bind the 
unfolded RNA and prevent misfolding. Subsequently, the RNA structure 
undergoes conformational rearrangements within the complex via multiple 
dissociations and associations until the correct conformation is attained and 
trapped by specific interactions with the protein. The high levels of nonspecific 
binding exhibited by some specific RNA-binding proteins like the Cyt-18 protein 



123 
of Neurospora (Saldanha et al, 1996) or the Cbp2 protein (this study) could reflect 

this chaperone activity. 

Equilibrium binding studies show that Cbp2 fails to discriminate between 
cognate (intron 5) and non-cognate (nrdB intron) RNAs at low Mg + 
concentrations (5 mM), suggesting that the protein may either possess a strong 
generalized RNA binding ability or may recognize, in part, features conserved 
among group I introns (Weeks and Cech, 1995a). Equilibrium filter binding 
analysis of wild-type and splicing-defective Cbp2 mutants revealed more or less 
comparable RNA binding profiles, demonstrating that Cbp2 possesses substantial 
non-specific or generalized RNA binding ability, and that mutations disrupting the 
splicing-enhancement function do not affect this property (Figure 4-6). This non- 
specific RNA binding displayed by Cbp2 at physiological Mg 2+ concentrations 
suggests that the protein may engage in a chaperone-like activity in vivo. 

Cbp2 stimulates intron 5 RNA splicing only in a narrow range of protein:RNA 
ratios, with severe inhibition of splicing activity at higher concentrations of 
protein. Addition of a non-specific competitor like tRNA alleviates this inhibition 
(Figure 4-10). Inhibition of RNA function at higher protein concentrations has 
been reported for RNA chaperones such as hnRNP Al, CI, U (Munroe and Dong, 
1992; Portman and Drey fuss, 1994) and the nucleocapsid (NC) protein of HIV- 1 
(Herschlag et al., 1994). In the case of hnRNP Al, inhibition of RNA annealing 
activity by excess protein was speculated to arise from the stabilization of single 
strands (Portman and Dreyfuss, 1994). For the NC protein, the inhibition of 



124 
hammerhead (HH16) catalysis was shown to result from protein binding to the 

ribozyme-substrate complex, blocking the cleavage step. Also, the inhibition 

observed with excess NC protein could be alleviated by the addition of ssDNA, a 

non-specific competitor (Herschlag et al, 1994). Thus, high concentrations of 

these proteins appear to bind more strongly to a denatured or inactive 

conformation rather than the active conformation of RNA, shutting down RNA 

function. Similarly, Cbp2 might stabilize misfolded rather than native 

conformations of intron 5 RNA at high proteimRNA ratios, inhibiting splicing. 

Modification studies at high proteimRNA ratios would verify this hypothesis, as 

the protection patterns of misfolded RNA would be different from the correctly 

folded conformation obtained at low protein:RNA ratios that are optimal for 

splicing (Shaw and Lewin, 1995). 

RNA chaperones, as mentioned earlier, aid in the process of RNA folding by 

preventing misfolding or by resolving misfolded species. For example, UP 1, the 

N-terminal fragment of hnRNP Al, was shown to renature 5S RNA and several 

tRNAs that were kinetically trapped in alternate conformations (Karpel et al., 

1974, 1982). Similarly, NC protein of HIV- 1 was shown to resolve a kinetically 

trapped, misfolded hammerhead ribozyme complex (Bertrand and Rossi, 1994; 

Herschlag et al., 1994; Muller et al, 1994; Tsuchihashi et al., 1993). The Cbp2 

protein also appears to resolve RNA structures that are kinetically trapped in 

misfolded conformations. Weeks and Cech (1995b) reported the formation of a 

promiscuous, inactive RNA structure (monitored by a UV-crosslink between the 



125 
core and 3'exon) at low Mg 2+ that was destabilized in the presence of Cbp2 and/or 

higher concentrations of Mg 2+ . Also, Shaw and Lewin (manuscript in preparation) 

observed that pre-incubation of intron 5 RNA with Cbp2 followed by addition of 

Mg 2+ (5mM) and GTP resulted in immediate onset of splicing. On the other hand, 

pre-incubation with Mg 2+ followed by addition of Cbp2 and GTP caused a lag in 

splicing. This lag may result from formation of misfolded RNA structures at low 

Mg 2+ that may have to be resolved by Cbp2 before splicing can occur. In addition, 

Cbp2, when present during transcription of intron 5 RNA, can mitigate the effects 

of certain RNA mutations that cannot be rescued by addition of protein after 

transcription (Lewin et al., 1995; Shaw et ai, 1996). Thus, during co- 

transcriptional splicing, Cbp2 appears to bind to nascent transcripts and help bias 

the RNA to fold correctly. 

The recent finding that the P4-P6 domain acts as a native kinetic trap for the 

Mg 2+ -dependent folding of the Tetrahymena ribozyme, slowing the folding of the 

P3-P7 domain (Trieber et al, 1998), raises the interesting possibility that 

stabilization of P4-P6 domain serves as a means to ensure correct RNA folding. 

RNA-binding proteins that stabilize P4-P6 domain may serve a similar purpose. 

The Cytl8 protein of Neurospora crassa, which promotes the splicing of several 

mitochondrial group I introns, has been shown to bind and stabilize the P4-P6 

domain of its cognate RNA (Saldanha et al, 1996). Similarly, the Cbp2 protein of 

S. cerevisiae has been to shown to make intimate contacts in the P4-P6 domain of 

intron 5 RNA (Shaw and Lewin, 1995), and stabilize this domain even in the 



126 
absence of Mg 2+ (Shaw and Lewin, manuscript in preparation). Though the Cyt- 

1 8 and Cbp2 proteins are specific RNA-binding proteins that promote splicing of 

only cognate RNAs, they exhibit substantial non-specific RNA binding activity 

(Saldanha et al., 1996; current study), a property of RNA chaperones. RNA 

chaperones are known to aid in correct RNA folding by preventing or slowing the 

formation of certain misfolded intramolecular structures (Herschlag, 1995). It is 

therefore interesting to speculate that RNA-binding proteins such as Cbp2 (and 

perhaps Cyt-18), which stabilize the formation of the P4-P6 domain, may also slow 

the folding of the rest of the molecule as a means to facilitate correct RNA folding, 

preventing the formation of misfolded structures. 

After Cbp2 facilitates the formation of the catalytic structure of intron 5 RNA 

(in the presence of Mg 2+ ), the protein can be removed by proteinase K digestion 

prior to the initiation of splicing without significant reduction in catalytic activity 

(Shaw and Lewin, manuscript in preparation). This suggests that Cbp2 is solely 

required for folding, similar to the S 12 ribosomal protein of E. coli, an RNA 

chaperone. RNA chaperones may stay bound to correctly folded RNA after 

exerting their chaperone activity due to the strength of non-specific RNA-protein 

interactions, serving additional specific roles (Herschlag et al., 1994). For 

example, the nucleocapsid (NC) protein of HIV- 1, an RNA chaperone, enhances 

catalysis of the hammerhead ribozyme (HH16) by not only increasing the rate of 

annealing of the ribozyme-substrate complex, but also by stimulating the rate of 

dissociation of the products (Herschlag et al., 1994). In the case of Cbp2, there is 



127 
evidence that the protein may remain bound to the splicing intermediates during 

catalysis. Organic extraction of proteinase K treated splicing reactions (described 

above) resulted in selective removal of the unspliced precursor and splicing 

intermediates (5' exon and intron-3' exon) from the aqueous phase, while the 

spliced products (ligated exons and free intron) remained in the aqueous phase 

(Shaw and Lewin, manuscript in preparation). Mei and Herschlag (1996) 

proposed that the release of ligated exons in vivo for the Tetrahymena group I 

intron reaction could be accomplished by changes in RNA structure brought about 

by either features intrinsic to the intron or cellular components such as RNA 

chaperones. Association of Cbp2 protein with the splicing intermediates during 

catalysis suggests that this protein could have an additional role in the dissociation 

of spliced products besides facilitating correct RNA folding. 

Thus, Cbp2 appears to have multiple roles in the facilitation of intron 5 RNA 

catalysis. The non-specific RNA binding or chaperone activity of Cbp2 may solve 

various kinetic problems of RNA folding, ensuring correct folding of intron 5 

RNA. The specific RNA binding activity of the protein can overcome the 

thermodynamic problem of RNA folding by stabilizing the catalytic conformation 

of RNA. In addition, Cbp2 may have a specific role in dissociation of the spliced 

products. Various steps in the protein-facilitated splicing of intron 5 RNA can be 

visualized as follows: Cbp2 may bind to the unfolded or nascent RNA and promote 

correct RNA folding by employing weak, non-specific and/or a subset of specific 

interactions. Charged residues in the protein (such as R20, R22, and K24) may 



128 
contribute to this non-specific RNA binding component. The correctly folded 

RNA may then access high affinity sites (such as the tyrosine residue at position 

21) on the Cbp2 protein through specific interactions, leading to stabilization of 

the catalytic structure and RNA splicing. 

From an evolutionary viewpoint, RNA chaperones might have evolved to 
rescue RNA molecules from kinetic traps and help them explore structural 
alternatives. These non-specific RNA-binding proteins subsequently might have 
acquired binding preferences (via cooperation between RNA and proteins) and 
evolved into specific RNA-binding proteins. For example, hnRNP Al protein, 
which has RNA chaperone activity (Herschlag et al, 1994; Portman and Dreyfuss, 
1994; Bertrand and Rossi, 1994), appears to have acquired a specific role in splice 
site selection (Caceres et al., 1994). The NC protein of HIV- 1 has chaperone 
activity and appears to bind specifically to viral RNA during packaging 
(Tsuchihashiefa/., 1994). 

Proteins involved in group I intron splicing might have evolved from pre- 
existing RNA-binding proteins (Akins and Lambowitz, 1987; Lambowitz and 
Perlman, 1990), as complex catalytic RNAs also appear to have originated from 
pre-existing structured RNAs (e.g., tRNAs or rRNAs). The tyrosyl tRNA 
synthetase (Cyt-18) of N. crassa, which also facilitates the splicing of several 
group I introns, might have acquired this property relatively later in evolution by 
recognizing a conserved tRNA-like structure in group I introns (Caprara etal, 
1996). Since intron 5 RNA is also a group I intron, it is likely that Cbp2 



129 
recognizes a similar tRNA-like structural motif in its cognate RNA. It is tempting 

to speculate that the generalized RNA binding activity common to these two 

proteins (Cyt-18 and Cbp2) may contribute to recognition of this conserved 

structural feature of group I introns, while the specific RNA binding ability may 

limit splicing enhancement to their cognate RNA partners. It is also interesting to 

note that these proteins retained their ancestral chaperone-like activity even after 

evolving into specific RNA-binding proteins, perhaps to their added advantage in 

solving various kinetic problems of RNA folding. 



LIST OF REFERENCES 

Akins, R. A., and A. M. Lambowitz. 1987. A protein required for splicing group I 
intron's in Ne'urospora mitochondria is mitochondrial tyrosyl-tRNA synthetase or a 
derivative thereof. Cell 50:331-345. 

Ansel McKinney, P., S. W. Scott, M. Swanson, X. Ge, and L. Gehrke. 1996. A 
plant viral coat protein RNA binding consensus sequence contains a crucial 
arginine [published erratum appears in EMBO J 1996 Dec 16;15(24):7188-9]. 
EMBOJ 15:5077-5084. 

Banroques, J., A. Delahodde, and C. Jacq. 1986. A mitochondrial RNA maturase 
gene transferred to the yeast nucleus can control mitochondrial mRNA splicing. 
Cell 46:837-844. 

Bass, B. L., and T. R. Cech. 1984. Specific interaction between the self-splicing 
RNA of Tetrahymena and its guanosine substrate: implications for biological 
catalysis by RNA. Nature 308:820-826. 

Beavis, R. C, and B. T. Chait. 1990. Rapid, sensitive analysis of protein mixtures 
by mass spectrometry. Proc Natl Acad Sci U S A 87:6873-6877. 

Been, M. D., and T. R. Cech. 1988. RNA as an RNA polymerase: net elongation 
of an RNA primer catalyzed by the Tetrahymena ribozyme. Science 239: 14 12- 
1416. 

Belfort, M., and P. S. Perlman. 1995. Mechanisms of intron mobility . J Biol 
Chem 270:30237-30240. 

Bell Pedersen, D., S. Quirk, J. Clyman, and M. Belfort. 1990. Intron mobility in 
phage T4 is dependent upon a distinctive class of endonucleases and independent 
of DNA sequences encoding the intron core: mechanistic and evolutionary 
implications. Nucleic Acids Res 18:3763-3770. 

Benner, S. A., A. D. Ellington, and A. Tauer. 1989. Modern metabolism as a 
palimpsest of the RNA world. Proc Natl Acad Sci U S A 86:7054-7058. 

130 



131 

Bevilacqua, P. C, and T. R. Cech. 1996. Minor-groove recognition of double- 
stranded RNA by the double-stranded RNA-binding domain from the RNA- 
activated protein kinase PKR. Biochemistry 35:9983-9994. 

Bornstein, P. 1977. Cleavage at asn-gly bonds with hydroxylamine. Methods 
Enzymol 78:132-145. 

Brehm, S. L., and T. R. Cech. 1983. Fate of an intervening sequence ribonucleic 
acid: excision and cyclization of the Tetrahymena ribosomal ribonucleic acid 
intervening sequence in vivo. Biochemistry 22:2390-2397. 

Burd, C. G., and G. Dreyfuss. 1994. Conserved structures and diversity of 
functions of RNA-binding proteins. Science 265:615-621. 

Burke, J. M. 1988. Molecular genetics of group I introns: RNA structures and 
protein factors required for splicing-a review. Gene 73:273-294. 

Byrk, M., and J. E. Mueller. 1996. In: Ribosomal RNA and Group I introns (R. 
Green, and R. Schroeder. ed.), Landes, R. J. (Austin, TX), pp. 221-241. 

Calnan, B. J., S. Biancalana, D. Hudson, and A. D. Frankel. 1991. Analysis of 
arginine-rich peptides from the HIV Tat protein reveals unusual features of RNA- 
protein recognition. Genes Dev 5:201-210. 

Caprara, M. G., V. Lehnert, A. M. Lambowitz, and E. Westhof. 1996. A tyrosyl- 
tRNA synthetase recognizes a conserved tRNA-like structural motif in the group I 
intron catalytic core. Cell 87:1135-1145. 

Carignani, G., O. Groudinsky, D. Frezza, E. Schiavon, E. Bergantino, and P. P. 
Slonimski. 1983. An mRNAmaturase is encoded by the first intron of the 
mitochondrial gene for the subunit I of cytochrome oxidase in S. cerevisiae. Cell 
35:733-742. 

Cate, J. H., and J. A. Doudna. 1996. Metal-binding sites in the major groove of a 
large ribozyme domain. Structure 4:1221-1229. 

Cate, J. H., A. R. Gooding, E. Podell, K. Zhou, B. L. Golden, A. A. Szewczak, C. 
E. Kundrot, T. R. Cech, and J. A. Doudna. 1996. RNA tertiary structure 
mediation by adenosine platforms. Science 273:1696-1699. 



132 

Cech, T. R. 1987. The chemistry of self-splicing RNA and RNA enzymes. 
Science 236:1532-1539. 

Cech, T. R. 1988. Conserved sequences and structures of group I introns: 
building an active site for RNA catalysis--a review. Gene 73:259-271. 

Cech, T. R. 1990. Self-splicing of group I introns. Annu Rev Biochem 59:543- 
568.' 

Cech, T. R. 1985. Self-splicing RNA: implications for evolution. IntRevCytol 
93:3-22. 

Cech, T. R., S. H. Damberger, and R. R. Gutell. 1994. Representation of the 
secondary and tertiary structure of group I introns. Nat Struct Biol 1 :273-280. 

Chait, B. T., R. Wang, R. C. Beavis, and S. B. Kent. 1993. Protein ladder 
sequencing. Science 262:89-92. 

Chang, B. Y., and R. H. Doi. 1993. Conformational properties of Bacillus subtilis 
RNA polymerase sigma A factor during transcription initiation. Biochem J 

294:43-47. 

Cherniack, A. D., G. Garriga, J. D. Kittle, Jr., R. A. Akins, and A. M. Lambowitz. 
1990. Function of Neurospora mitochondrial tyrosyl-tRNA synthetase in RNA 
splicing requires an idiosyncratic domain not found in other synthetases. Cell 
62:745-755. 

Chu, D. M., J. D. Corbin, K. A. Grimes, and S. H. Francis. 1997. Activation by 
cyclic GMP binding causes an apparent conformational change in cGMP- 
dependent protein kinase. J Biol Chem 272:3 1922-3 1928. 

Cleghon, V., and D. F. Klessig. 1992. Characterization of the nucleic acid 
binding region of adenovirus DNA-binding protein by partial proteolysis and 
photochemical cross-linking. J Biol Chem 267:17872-17881. 

Coetzee, T., D. Herschlag, and M. Belfort. 1994. Escherichia coli proteins, 
including ribosomal protein SI 2, facilitate in vitro splicing of phage T4 introns by 
acting as RNA chaperones. Genes Dev 8:1575-1588. 



133 

Cummings, D. J., J. M. Domenico, and F. Michel. 1988. DNA sequence and 
organization of the mitochondrial ND1 gene from Podospora anserina: analysis of 
alternate splice sites. Curr Genet 14:253-264. 

Cunningham, B. C, and J. A. Wells. 1989. High-resolution epitope mapping of 
hGH-receptor interactions by alanine-scanning mutagenesis. Science 244:1081- 
1085. 

Davies, J. 1990. What are antibiotics? Archaic functions for modern activities. 
Mol Microbiol 4:1227-1232. 

Davies, J., U. von Ahsen, H. Wank, and R. Schroeder. 1992. Evolution of 
secondary metabolite production: potential roles for antibiotics as prebiotic 
effectors of catalytic RNA reactions. Ciba Found Symp 171:24-32. 

Davies, R. W., R. B. Waring, J. A. Ray, T. A. Brown, and C. Scazzocchio. 1982. 
Making ends meet: a model for RNA splicing in fungal mitochondria. Nature 
300:719-724. 

Decatur, W. A., C. Einvik, S. Johansen, and V. M. Vogt. 1995. Two group I 
ribozymes with different functions in a nuclear rDNA intron. EMBO J 14:4558- 
4568. 

Degani, Y., and A. Patchornik. 1974. Cyanylation of sulfhydryl groups by 2- 
nitro-5-thiocyanobenzoic acid. High-yield modification and cleavage of peptides 
at cysteine residues. Biochemistry 13:1-11. 

Dujon, B. 1989. Group I introns as mobile genetic elements: facts and 
mechanistic speculations-a review. Gene 82:91-114. 

Eickbush, T. H. 1994. In: Evolutionary biology of viruses (S. S. Morse, ed.), 
Raven (New York), pp. 121-157. 

Einvik, C, W. A. Decatur, T. M. Embley, V. M. Vogt, and S. Johansen. 1997. 
Naegleria nucleolar introns contain two group I ribozymes with different functions 
in RNA splicing and processing. RNA 3:710-720. 

Forster, A. C., and S. Altaian. 1990. External guide sequences for an RNA 
enzyme. Science 249:783-786. 



134 

Gampel, A., M. Nishikimi, and A. Tzagoloff. 1989. CBP2 protein promotes in 
vitro excision of a yeast mitochondrial group I intron. Mol Cell Biol 9:5424- 
5433. 

Gampel, A., and A. Tzagoloff. 1987. In vitro splicing of the terminal intervening 
sequence of Saccharomyces cerevisiae cytochrome b pre-mRNA. Mol Cell Biol 

7:2545-2551. 

Garriga, G., and A. M. Lambowitz. 1986. Protein-dependent splicing of a group I 
intron in ribonucleoprotein particles and soluble fractions. Cell 46:669-680. 

Garriga, G., and A. M. Lambowitz. 1984. RNA splicing in neurospora 
mitochondria: self-splicing of a mitochondrial intron in vitro. Cell 39:631-641. 

Gatignol, A., C. Buckler, and K. T. Jeang. 1993. Relatedness of an RNA-binding 
motif in human immunodeficiency virus type 1 TAR RNA-binding protein TRBP 
to human PI /dsl kinase and Drosophila staufen. Mol Cell Biol 13:2193-2202. 

Gatignol, A., A. Buckler White, B. Berkhout, and K. T. Jeang. 1991. 
Characterization of a human TAR RNA-binding protein that activates the HIV-1 
LTR. Science 251:1597-1600. 

Gonsalves, D., and S. M. Garnsey. 1975. Infectivity of heterologous RNA-protein 
mixtures from alfalfa mosaic, citrus leaf rugose, citrus variegation, and tobacco 
streak viruses. Virology 67:319-326. 

Gott, J. M., M. C. Willis, T. H. Koch, and O. C. Uhlenbeck. 1991. A specific, 
UV-induced RNA-protein cross-link using 5-bromouridine-substituted RNA. 
Biochemistry 30:6290-6295. 

Green, R., and J. W. Szostak. 1992. Selection of a ribozyme that functions as a 
superior template in a self-copying reaction. Science 258:1910-1915. 

Green, S. R., and M. B. Mathews. 1992. Two RNA-binding motifs in the double- 
stranded RNA-activated protein kinase, DAI. Genes Dev 6:2478-2490. 

Grosshans, C. A., and T. R. Cech. 1989. Metal ion requirements for sequence- 
specific endoribonuclease activity of the Tetrahymena ribozyme. Biochemistry 
28:6888-6894. 



135 

Guthrie, C. 1991 . Messenger RNA splicing in yeast: clues to why the 
spliceosome is a ribonucleoprotein. Science 253:157-163. 

Hay, R.T., and J. Nicholson. 1993. DNA binding alters the protease 
susceptibility of the p50 subunit of NF-kappa B. Nucleic Acids Res 21:4592- 
4598. 

Herbert, C. J., M. Labouesse, G. Dujardin, and P. P. Slonimski. 1988. The NAM2 
proteins from S. cerevisiae and S. douglasii are mitochondrial leucyl-tRNA 
synthetases, and are involved in mRNA splicing. EMBO J 7:473-483. 

Herschlag, D. 1992. Evidence for processivity and two-step binding of the RNA 
substrate from studies of J 1/2 mutants of the Tetrahymena ribozyme. 
Biochemistry 31:1386-1399. 

Herschlag, D. 1995. RNA chaperones and the RNA folding problem. J Biol 
Chem 270:20871-20874. 

Herschlag, D., and T. R. Cech. 1990. Catalysis of RNA cleavage by the 
Tetrahymena thermophila ribozyme. 1. Kinetic description of the reaction of an 
RNA substrate complementary to the active site. Biochemistry 29:10159-10171. 

Herschlag, D., and T. R. Cech. 1990. DNA cleavage catalysed by the ribozyme 
from Tetrahymena [published erratum appears in Nature 1990 Apr 
19;344(6268):792]. Nature 344:405-409. 

Herschlag, D., M. Khosla, Z. Tsuchihashi, and R L. Karpel. 1994. An RNA 
chaperone activity of non-specific RNA-binding proteins in hammerhead ribozyme 
catalysis [published erratum appears in EMBO J 1994 Aug 15;13(16):3926]. 
EMBO J 13:2913-2924. 

Hicke, B. J., E. L. Christian, and M. Yarus. 1989. Stereoselective arginine 
binding is a phylogenetically conserved property of group I self-splicing RNAs. 
EMBO J 8:3843-3851. 

Hill, J., P. McGraw, and A. Tzagoloff. 1985. A mutation in yeast mitochondrial 
DNA results in a precise excision of the terminal intron of the cytochrome b gene. 
J Biol Chem 260:3235-3238. 



136 

Hillenkamp, F., M. Karas, R. C. Beavis, and B. T. Chait. 1991. Matrix-assisted 
laser desorption/ionization mass spectrometry of biopolymers. Anal Chem 
63:1193-1203. 

Ho, Y., S. J. Kim, and R. B. Waring. 1997. A protein encoded by a group I intron 
in Aspergillus nidulans directly assists RNA splicing and is a DNA endonuclease. 
Proc Natl Acad Sci U S A 94:8994-8999. 

Holl, J., C. Schmidt, and R. J. Schweiyen. 1985. In: Achievements and 
perspectives of mitochondrial research, Vol.11, Biogenesis (E. Quagliariello, E. C. 
Slater, F. Palmieri, C. Saccone, and A. M. Kroon. ed.), Elsevier (Amsterdam), pp. 
227-236. 

Huang, F., and M. Yarus. 1997a. 5'-RNA self-capping from guanosine 
diphosphate. Biochemistry 36:6557-6563. 

Huang, F., and M. Yarus. 1997b. A calcium-metalloribozyme with autodecapping 
and pyrophosphatase activities. Biochemistry 36:14107-14119. 

Hunter, T., T. Hunt, R. J. Jackson, and H. D. Robertson. 1975. The characteristics 
of inhibition of protein synthesis by double-stranded ribonucleic acid in 
reticulocyte lysates. J Biol Chem 250:409-417. 

Ikeda, M, E. C. Wilcox, and W. W. Chin. 1996. Different DNA elements can 
modulate the conformation of thyroid hormone receptor heterodimer and its 
transcriptional activity. J Biol Chem 271:23096-23104. 

Illangasekare, M., O. Kovalchuke, and M. Yarus. 1997. Essential structures of a 
self-aminoacylating RNA. JMolBiol 274:519-529. 

Illangasekare, M., G. Sanchez, T. Nickles, and M. Yarus. 1995. Aminoacyl-RNA 
synthesis catalyzed by an RNA. Science 267:643-647. 

Inoue, T., F. X. Sullivan, and T. R. Cech. 1986. New reactions of the ribosomal 
RNA precursor of Tetrahymena and the mechanism of self-splicing. J Mol Biol 
189:143-165. 

Jabri, E., S. Aigner, and T. R. Cech. 1997. Kinetic and secondary structure 
analysis of Naegleria andersoni GIR1, a group I ribozyme whose putative 
biological function is site-specific hydrolysis. Biochemistry 36:16345-16354. 



137 

Jacobson, G. R, M. H. Schaffer, G. R. Stark, and T. C. Vanaman. 1973. Specific 
chemical cleavage in high yield at the amino peptide bonds of cysteine and cystine 
residues. J Biol Chem 248:6583-6591. 

Jaeger, L., E. Westhof, and F. Michel. 1991. Function of PI 1, a tertiary base 
pairing in self-splicing introns of subgroup IA. J Mol Biol 221:1 153-1 164. 

Joyce, G. F., G. van der Horst, and T. Inoue. 1989. Catalytic activity is retained in 
the Tetrahymena group I intron despite removal of the large extension of element 
P5. Nucleic Acids Res 17:7879-7889. 

Kamper, U., U. Kuck, A. D. Cherniack, and A. M. Lambowitz. 1992. The 
mitochondrial tyrosyl-tRNA synthetase of Podospora anserina is a bifunctional 
enzyme active in protein synthesis and RNA splicing. Mol Cell Biol 12:499-51 1. 

Karas, M., and F. Hillenkamp. 1988. Laser desorption ionization of proteins with 
molecular masses exceeding 10,000 daltons. Anal Chem 60:2299-2301. 

Kennell, J. C, J. V. Moran, P. S. Perlman, R. A. Butow, and A. M. Lambowitz. 
1993. Reverse transcriptase activity associated with maturase-encoding group II 
introns in yeast mitochondria. Cell 73:133-146. 

Kharrat, A., M. J. Macias, T. J. Gibson, M. Nilges, and A. Pastore. 1995. 
Structure of the dsRNA binding domain of E. coli RNase III. EMBO J 14:3572- 
3584. 

King, G. C, and J. E. Coleman. 1988. The Ff gene 5 protein-d(pA)40-60 
complex: 1H NMR supports a localized base-binding model. Biochemistry 
27:6947-6953. 

Kittle, J. D., Jr., G. Mohr, J. A. Gianelos, H. Wang, and A. M. Lambowitz. 1991. 
The Neurospora mitochondrial tyrosyl-tRNA synthetase is sufficient for group I 
intron splicing in vitro and uses the carboxy-terminal tRNA-binding domain along 
with other regions. Genes Dev 5 : 1 009- 1 02 1 . 

Kreike, J., M. Schulze, F. Ahne, and B. F. Lang. 1987. A yeast nuclear gene, 
MRS1, involved in mitochondrial RNA splicing: nucleotide sequence and 
mutational analysis of two overlapping open reading frames on opposite strands. 
EMBO J 6:2123-2129. 



138 

Kreike, J., M. Schulze, T. Pillar, A. Korte, and G. Rodel. 1986. Cloning of a 
nuclear gene MRS1 involved in the excision of a single group I intron (bI3) from 
the mitochondrial COB transcript in S. cerevisiae. Curr Genet 1 1:185-191. 

Kumar, A., and S. H. Wilson. 1990. Studies of the strand-annealing activity of 
mammalian hnRNP protein Al. Biochemistry 29:10717-10722. 

Kurz, J. C, S. Niranjanakumari, and C. A. Fierke. 1998. Protein component of 
Bacillus subtilis RNase P specifically enhances the affinity for precursor- 
tRNAAsp. Biochemistry 37:2393-400. 

Labouesse, M., C. J. Herbert, G. Dujardin, and P. P. Slonimski. 1987. Three 
suppressor mutations which cure a mitochondrial RNA maturase deficiency occur 
at the same codon in the open reading frame of the nuclear NAM2 gene. EMBO J 
6:713-721. 

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the 
head of bacteriophage T4. Nature 227:680-685. 

Lamb, M. R., P. Q. Anziano, K. R. Glaus, D. K. Hanson, H. J. Klapper, P. S. 
Perlm'an, and H. R. Mahler. 1983. Functional domains in introns. RNA 
processing intermediates in cis- and trans-acting mutants in the penultimate intron 
of the mitochondrial gene for cytochrome b. J Biol Chem 258:1991-1999. 

Lambowitz, A. M., and P. S. Perlman. 1990. Involvement of aminoacyl-tRNA 
synthetases and other proteins in group I and group II intron splicing. Trends 
BiochemSci 15:440-444. 

Lazinski, D., E. Grzadzielska, and A. Das. 1989. Sequence-specific recognition 
of RNA hairpins by bacteriophage antiterminators requires a conserved arginine- 
rich motif. Cell 59:207-218. 

Lazowska, J., M. Claisse, A. Gargouri, Z. Kotylak, A. Spyridakis, and P. P. 
Slonimski. 1989. Protein encoded by the third intron of cytochrome b gene in 
Saccharomyces cerevisiae is an mRNA maturase. Analysis of mitochondrial 
mutants, RNA transcripts proteins and evolutionary relationships. J Mol Biol 
205:275-289. 

Lazowska, J., T. Szczepanek, C. Macadre, and M. Dokova. 1992. Two 
homologous mitochondrial introns from closely related Saccharomyces species 



139 

differ by only a few amino acid replacements in their Open Reading Frames: one is 
mobile, the other is not. CR Acad Sci III 315:37-41. 

LeCuyer, K. A., L. S. Behlen, and O. C. Uhlenbeck. 1996. Mutagenesis of a 
stacking contact in the MS2 coat protein-RNA complex. EMBO J 15:6847-6853. 

LeCuyer, K. A., L. S. Behlen, and O. C. Uhlenbeck. 1995. Mutants of the 
bacteriophage MS2 coat protein that alter its cooperative binding to RNA. 
Biochemistry 34:10600-10606. 

Li, G. Y., G. L. Tian, P. P. Slonimski, and C. J. Herbert. 1996. The CBP2 gene 
from Saccharomyces douglasii is a functional homologue of the Saccharomyces 
cerevisiae gene and is essential for respiratory growth in the presence of a wild- 
type (intron-containing) mitochondrial genome. Mol Gen Genet 250:316-322. 

Liu, X., P. Garriga, and H. G. Khorana. 1996. Structure and function in 
rhodopsin: correct folding and misfolding in two point mutations in the intradiscal 
domain of rhodopsin identified in retinitis pigmentosa. Proc. Natl. Acad. Sci. 
93:4554-4559. 

Madhani, H. D., and C. Guthrie. 1992. A novel base-pairing interaction between 
U2 and U6 snRNAs suggests a mechanism for the catalytic activation of the 
spliceosome. Cell 71:803-817. 

Majerfeld, I., and M. Yarns. 1994. An RNA pocket for an aliphatic hydrophobe 
[see comments]. Nat Struct Biol 1:287-292. 

Matsuura, M, R. Saldanha, H. Ma, H. Wank, J. Yang, G. Mohr, S. Cavanagh, G. 
M. Dunny, M. Belfort, and A. M. Lambowitz. 1997. A bacterial group II intron 
encoding reverse transcriptase, maturase, and DNA endonuclease activities: 
biochemical demonstration of maturase activity and insertion of new genetic 
information within the intron. Genes Dev 1 1 :29 1 0-2924. 

McConnell, T. S., D. Herschlag, and T. R. Cech. 1997. Effects of divalent metal 
ions on individual steps of the Tetrahymena ribozyme reaction. Biochemistry 
36:8293-8303. 

McCormack, S. J., D. C. Thomis, and C. E. Samuel. 1992. Mechanism of 
interferon action: identification of a RNA binding domain within the N-terminal 
region of the human RNA-dependent Pl/eIF-2 alpha protein kinase. Virology 
188:47-56. 



140 



McGraw, P., and A. Tzagoloff. 1983. Assembly of the mitochondrial membrane 
system. Characterization of a yeast nuclear gene involved in the processing of the 
cytochrome b pre-mRNA. JBiolChem 258:9459-9468. 

McPheeters, D. S., and J. Abelson. 1992. Mutational analysis of the yeast U2 
snRNA suggests a structural similarity to the catalytic core of group I introns. Cell 
71:819-831. 

Mei, R., and D. Herschlag. 1996. Mechanistic investigations of a ribozyme 
derived from the Tetrahymena group I intron: Insights into catalysis and the second 
step of self-splicing. Biochemistry 35:5796-5809. 

Merrill, B. M, K. L. Stone, F. Cobianchi, S. H. Wilson, and K. R. Williams. 1988. 
Phenylalanines that are conserved among several RNA-binding proteins form part 
of a nucleic acid-binding pocket in the Al heterogeneous nuclear 
ribonucleoprotein. JBiolChem 263:3307-3313. 

Merrill, B. M., K. R. Williams, J. W. Chase, and W. H. Konigsberg. 1984. 
Photochemical cross-linking of the Escherichia coli single-stranded DNA-binding 
protein to oligodeoxynucleotides. Identification of phenylalanine 60 as the site of 
cross-linking. JBiolChem 259:10850-10856. 

Meunier, B., T. G.-L., C. Macadre, P. P. Slonimski, and J. Lazowska. 1990. 
Group II introns transpose in yeast mitochondria. In: Structure, function and 
biogenesis of energy transfer systems (E. Quagliariello, S. Papa, F. Palmieri, and 
C. Saccone. ed.), Elsevier Science Publishers (Amsterdam), pp. 169-174. 

Michel, F., A. Jacquier, and B. Dujon. 1982. Comparison of fungal mitochondrial 
introns reveals extensive homologies in RNA secondary structure. Biochimie 
64:867-881. 

Michel, F., and E. Westhof. 1990. Modelling of the three-dimensional 
architecture of group I catalytic introns based on comparative sequence analysis. J 
MolBiol 216:585-610. 

Moazed, D., and H. F. Noller. 1987. Chloramphenicol, erythromycin, carbomycin 
and vernamycin B protect overlapping sites in the peptidyl transferase region of 
23S ribosomal RNA. Biochimie 69:879-884. 



141 

Modarress, K. J., J. Opoku, M. Xu, N. J. Sarlis, and S. S. Simons, Jr. 1997. 
Steroid-induced conformational changes at ends of the hormone-binding domain in 
the rat glucocorticoid receptor are independent of agonist versus antagonist 
activity. JBiolChem 272:23986-23994. 

Mogridge, J., T. F. Mah, and J. Greenblatt. 1998. Involvement of boxA 
nucleotides in the formation of a stable ribonucleoprotein complex containing the 
bacteriophage lambda N protein. JBiolChem 273:4143-4148. 

Mohr, G., M. G. Caprara, Q. Guo, and A. M. Lambowitz. 1994. A tyrosyl-tRNA 
synthetase can function similarly to an RNA structure in the Tetrahymena 
ribozyme [see comments]. Nature 370:147-150. 

Munroe, S. H., and X. Dong. 1992. Heterogeneous nuclear ribonucleoprotein Al 
catalyzes RNA-RNA annealing. Proc. Natl. Acad. Sci. 89:895-899. 

Myers, C. A., G. J. Wallweber, R. Rennard, Y. Kernel, M. G. Caprara, G. Mohr, 
and A.' M. Lambowitz. 1996. A tyrosyl-tRNA synthetase suppresses structural 
defects in the two major helical domains of the group I intron catalytic core. J Mol 
Biol 262:87-104. 

Narlikar, G. J., and D. Herschlag. 1996. Isolation of a local tertiary folding 
transition in the context of a globally folded RNA. Nat Struct Biol 3:701-710. 

Noller, H. F., V. Hoffarth, and L. Zimniak. 1992. Unusual resistance of peptidyl 
transferase to protein extraction procedures [see comments]. Science 256:1416- 

1419. 

Palmer, J. D., and J. M. Logsdon, Jr. 1991. The recent origins of introns. Curr 
Opin Genet Dev 1 :470-477. 

Pan, J., D. Thirumalai, and S. A. Woodson. 1997. Folding of RNA involves 
parallel pathways. J Mol Biol 273:7-13. 

Paradiso, P. R., and W. Konigsberg. 1982. Photochemical cross-linking of the 
gene 5 protein.fd DNA complex from fd-infected cells. J Biol Chem 257:1462- 
1467. 



142 

Paradiso, P. R., Y. Nakashima, and W. Konigsberg. 1979. Photochemical cross- 
linking of protein . nucleic acid complexes. The attachment of the fd gene 5 
protein to fd DNA. J Biol Chem 254:4739-4744. 

Parker, E. J., C. H. Botting, A. Webster, and R. T. Hay. 1998. Adenovirus DNA 
polymerase: domain organisation and interaction with preterminal protein. Nucleic 
Acids Res 26:1240-1247. 

Partono, S., and A. S. Lewin. 1988. Autocatalytic activities of intron 5 of the cob 
gene of yeast mitochondria. Mol Cell Biol 8:2562-2571. 

Partono, S., and A. S. Lewin. 1991. The rate and specificity of a group I ribozyme 
are inversely affected by choice of monovalent salt. Nucleic Acids Res 19:605- 
609. 

Perlman, P. S., and R. A. Butow. 1989. Mobile introns and intron-encoded 
proteins. Science 246:1106-1109. 

Petersen, J. M., J. J. Skalicky, L. W. Donaldson, L. P. Mcintosh, T. Alber, and B. 
J. Graves. 1995. Modulation of transcription factor Ets-1 DNA binding: DNA- 
induced unfolding of an alpha helix. Science 269:1866-1869. 

Piccirilli, J. A., T. S. McConnell, A. J. Zaug, H. F. Noller, and T. R. Cech. 1992. 
Aminoacyl esterase activity of the Tetrahymena ribozyme [see comments]. 
Science 256:1420-1424. 

Portman, D. S., and G. Dreyfuss. 1994. RNA annealing activities in HeLa nuclei. 
EMBOJ 13:213-221. 

Powers, T., and H. F. Noller. 1994. Selective perturbation of G530 of 16 S rRNA 
by translational miscoding agents and a streptomycin-dependence mutation in 
protein S12. J Mol Biol 235:156-172. 

Pyle, A. M., and T. R. Cech. 1991 . Ribozyme recognition of RNA by tertiary 
interactions with specific ribose 2'-OH groups. Nature 350:628-63 1 . 

Pyle, A. M., J. A. McSwiggen, and T. R. Cech. 1990. Direct measurement of 
oligonucleotide substrate binding to wild-type and mutant ribozymes from 
Tetrahymena. Proc Natl Acad Sci U S A 87:8187-8191. 



143 

Pyle, A. M., S. Moran, S. A. Strobel, T. Chapman, D. H. Turner, and T. R. Cech. 
1994. Replacement of the conserved G.U with a G-C pair at the cleavage site of 
the Tetrahymena ribozyme decreases binding, reactivity, and fidelity. 
Biochemistry 33:13856-13863. 

Pyle, A. M., F. L. Murphy, and T. R. Cech. 1992. RNA substrate binding site in 
the catalytic core of the Tetrahymena ribozyme. Nature 358:123-128. 

Reinhold Hurek, B., and D. A. Shub. 1992. Self-splicing introns in tRNA genes 
of widely divergent bacteria. Nature 357:173-176. 

Reusken, C. B., L. Neeleman, and J. F. Bol. 1995. Ability of tobacco streak virus 
coat protein to substitute for late functions of alfalfa mosaic virus coat protein. J 
Virol 69:4552-4555. 

Robertson, D. L., and G. F. Joyce. 1990. Selection in vitro of an RNA enzyme 
that specifically cleaves single-stranded DNA. Nature 344:467-468. 

Rogers, J., A. H. Chang, U. von Ahsen, R. Schroeder, and J. Davies. 1996. 
Inhibiti'on'of the self-cleavage reaction of the human hepatitis delta virus ribozyme 
by antibiotics. J Mol Biol 259:916-925. 

Roman, J., and S. A. Woodson. 1998. Integration of the Tetrahymena group I 
intron into bacterial rRNA by reverse splicing in vivo. Proc Natl Acad Sci U S A 
95:2134-2139. 

Safer, B., R. B. Cohen, S. Garfinkel, and J. A. Thompson. 1988. DNA affinity 
labeling of adenovirus type 2 upstream promoter sequence-binding factors 
identifies two distinct proteins. Mol Cell Biol 8:105-113. 

Saldanha, R., A. Ellington, and A. M. Lambowitz. 1996. Analysis of the CYT-18 
protein binding site at the junction of stacked helices in a group I intron RNA by 
quantitative binding assays and in vitro selection. J Mol Biol 261:23-42. 

Saldanha, R., G. Mohr, M. Belfort, and A. M. Lambowitz. 1993. Group I and 
group II introns. FASEB J. 7:15-24. 

Schagger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate- 
polyacrylamide gel electrophoresis for the separation of proteins in the range from 
ltolOOkDa. AnalBiochem 166:368-379. 



144 

Sclavi, B., M. Sullivan, M. R. Chance, M. Brenowitz, and S. A. Woodson. 1998. 
RNA folding at millisecond intervals by synchrotron hydroxyl radical footprinting. 
Science 279:1940-1943. 

Sellem, C. H., and L. Belcour. 1997. Intron open reading frames as mobile 
elements and evolution of a group I intron. Mol Biol Evol 14:518-526. 

Sellem, C. H., Y. d'Aubenton Carafa, M. Rossignol, and L. Belcour. 1996. 
Mitochondrial intronic open reading frames in Podospora: mobility and 
consecutive exonic sequence variations. Genetics 143:777-788. 

Seraphin, B., M. Simon, A. Boulet, and G. Faye. 1989. Mitochondrial splicing 
requires a protein from a novel helicase family. Nature 337:84-87. 

Shamoo, Y., K. R. Williams, and W. H. Konigsberg. 1988. Photochemical 
crosslinking of bacteriophage T4 single-stranded DNA-binding protein (gp32) to 
oligo-p(dT)8: identification of phenylalanine- 183 as the site of crosslinking. 
Proteins 4:1-6. 

Sharp, P. A. 1985. On the origin of RNA splicing and introns. Cell 42:397-400. 

Shaw, L. C, and A. S. Lewin. 1997. The Cbp2 protein stimulates the splicing of 
the omega intron of yeast mitochondria. Nucleic Acids Res 25:1597-1604. 

Shaw, L. C, and A. S. Lewin. 1995. Protein-induced folding of a group I intron 
in cytochrome b pre-mRNA. J Biol Chem 270:21552-21562. 

Shaw, L. C, J. Thomas, Jr., and A. S. Lewin. 1996. The Cbp2 protein suppresses 
splice site mutations in a group I intron. Nucleic Acids Res 24:3415-3423. 

Shetlar, M. D. 1980. Cross-linking of proteins to nucleic acids by ultraviolet 
light. In: Photochemical and Photobiological reviews (K. C. Smith, ed.), Plenum 
Press (New York), pp. 105-197. 

St Johnston, D., N. H. Brown, J. G. Gall, and M. Jantsch. 1992. A conserved 
double-stranded RNA-binding domain. Proc Natl Acad Sci U S A 89:10979- 
10983. 

Steitz, J. A. 1992. Splicing takes a holliday [see comments]. Science 257:888- 
889. 



145 



Steitz, T. A., and J. A. Steitz. 1993. A general two-metal-ion mechanism for 
catalytic RNA. Proc Natl Acad Sci U S A 90:6498-6502. 

Strobel, S. A., and T. R. Cech. 1995. Minor groove recognition of the conserved 
G.U pair at the Tetrahymena ribozyme reaction site. Science 267:675-679. 

Strobel, S. A., and T. R. Cech. 1993. Tertiary interactions with the internal guide 
sequence mediate docking of the PI helix into the catalytic core of the 
Tetrahymena ribozyme. Biochemistry 32:13593-13604. 

Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of 
T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol 
185:60-89. 

Szczepanek, T., and J. Lazowska. 1996. Replacement of two non-adjacent amino 
acids in the S.cerevisiae bi2 intron-encoded RNA maturase is sufficient to gain a 
homing-endonuclease activity. EMBO J 15:3758-3767. 

Tan, R., L. Chen, J. A. Buettner, D. Hudson, and A. D. Frankel. 1993. RNA 
recognition by an isolated alpha helix. Cell 73:1031-1040. 

Tanner, N. K., M. M. Hanna, and J. Abelson. 1988. Binding interactions between 
yeast tRNA ligase and a precursor transfer ribonucleic acid containing two 
photoreactive uridine analogues. Biochemistry 27:8852-8861. 

Thompson, A. J., and D. L. Herrin. 1994. A chloroplast group I intron undergoes 
the first step of reverse splicing into host cytoplasmic 5.8 S rRNA. Implications for 
intron-mediated RNA recombination, intron transposition and 5.8 S rRNA 
structure. J Mol Biol 236:455-468. 

Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of 
proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some 
applications. Proc Natl Acad Sci U S A 76:4350-4354. 

Treiber, D. K., M. S. Rook, P. P. Zarrinkar, and J. R. Williamson. 1998. Kinetic 
intermediates trapped by native interactions in RNA folding. Science 279:1943- 
1946. 



146 

Vaisanen, S., K. Juntunen, A. Itkonen, P. Vihko, and P. H. Maenpaa. 1997. 
Conformational studies of human vitamin-D receptor by antipeptide antibodies, 
partial proteolytic digestion and ligand binding. Eur J Biochem 248:156-162. 

Valegard, K., J. B. Murray, P. G. Stockley, N. J. Stonehouse, and L. Liljas. 1994. 
Crystal structure of an RNA bacteriophage coat protein-operator complex. Nature 
371:623-626. 

van der Horst, G., and H. F. Tabak. 1985. Self-splicing of yeast mitochondrial 
ribosomal and messenger RNA precursors. Cell 40:759-766. 

van Vloten-Doting, L. 1975. Coat protein is required for infectivity of tobacco 
streak virus: biological equivalence of the coat proteins of tobacco streak and 
alfalfa mosaic viruses. Virology 65:215-225. 

Visser, C. M. 1984. Evolution of biocatalysis 2. Nicotinamide and/or flavin- 
containing RNA molecules as possible pre-genetic-code replicating oxido- 
reductases. OrigLife 14:301-305. 

von Ahsen, U., J. Davies, and R. Schroeder. 1991. Antibiotic inhibition of group I 
ribozyme function [see comments]. Nature 353:368-370. 

von Ahsen, U., and H. F. Noller. 1993. Footprinting the sites of interaction of 
antibiotics with catalytic group I intron RNA [see comments]. Science 260:1500- 
1503. 

von Heijne, G. 1986. Mitochondrial targeting sequences may form amphiphilic 
helices. EMBOJ 5:1335-1342. 

Wallweber, G. J., S. Mohr, R. Rennard, M. G. Caprara, and A. M. Lambowitz. 
1997. Characterization of Neurospora mitochondrial group I introns reveals 
different CYT-18 dependent and independent splicing strategies and an alternative 
3* splice site for an intron ORF. RNA 3:114-131. 

Wang, J. F., and T. R. Cech. 1992. Tertiary structure around the guanosine- 
binding site of the Tetrahymena ribozyme. Science 256:526-529. 

Wank, H., and R. Schroeder. 1996. Antibiotic-induced oligomerisaation of group 
I intron RNA. J. Mol. Biol. 258:53-61. 



147 

Weeks, K. M., and T. R. Cech. 1996. Assembly of a ribonucleoprotein catalyst by 
tertiary structure capture. Science 271:345-348. 

Weeks, K. M., and T. R. Cech. 1995a. Efficient protein-facilitated splicing of the 
yeast mitochondrial bI5 intron. Biochemistry 34:7728-7738. 

Weeks, K. M., and T. R. Cech. 1995b. Protein facilitation of group I intron 
splicing by assembly of the catalytic core and the 5' splice site domain. Cell 
82:221-230. 

Weinstein, L. B., B. C. N. M. Jones, R. Cosstick, and T. R. Cech. 1997. A second 
catalytic metal ion in a group I ribozyme. Nature 388:805-808. 

Welch, M., I. Majerfeld, and M. Yarus. 1997. 23S rRNA similarity from selection 
for peptidyl transferase mimicry. Biochemistry 36:6614-6623. 

Whelihan, E. F., and P. Schimmel. 1997. Rescuing an essential enzyme RNA 
complex with a non-essential appended domain. EMBO J 16:2968-2974. 

Wiesenberger, G., M. Waldherr, and R. J. Schweyen. 1992. The nuclear gene 
MRS2 is essential for the excision of group II introns from yeast mitochondrial 
transcripts in vivo. J Biol Chem 267:6963-6969. 

Williams, K. R., and W. H. Konigsberg. 1991. Identification of amino acid 
residues at interface of protein-nucleic acid complexes by photochemical cross- 
linking. Methods Enzymol 208:516-539. 

Willis, M. C, B. J. Hicke, O. C. Uhlenbeck, T. R. Cech, and T. H. Koch. 1993. 
Photocrosslinking of 5-iodouracil-substituted RNA and DNA to proteins. Science 
262:1255-1257. 

Wong, I., and T. M. Lohman. 1993. A double-filter method for nitrocellulose- 
filter binding: application to protein-nucleic acid interactions. Proc Natl Acad Sci 
USA 90:5428-5432. 

Woodson, S. A., and T. R. Cech. 1989. Reverse self-splicing of the tetrahymena 
group I intron: implication for the directionality of splicing and for intron 
transposition. Cell 57:335-345. 



148 

Yamada, T., Y. Mizugichi, K. H. Nierhaus, and H. G. Wittmann. 1978. 
Resistance to viomycin conferred by RNA of either ribosomal subunit. Nature 
275:460-461. 

Yang, J., S. Zimmerly, P. S. Perlman, and A. M. Lambowitz. 1996. Efficient 
integration of an intron RNA into double-stranded DNA by reverse splicing [see 
comments]. Nature 381:332-335. 

Yarus, M. 199 1 . An RNA-amino acid complex and the origin of the genetic code. 
New Biol 3:183-189. 

Zamore, P. D., and M. R. Green. 1989. Identification, purification, and 
biochemical characterization of U2 small nuclear ribonucleoprotein auxiliary 
factor. ProcNatlAcadSciUSA 86:9243-9247. 

Zimmerly, S., H. Guo, R. Eskes, J. Yang, P. S. Perlman, and A. M. Lambowitz. 
1995. A group II intron RNA is a catalytic component of a DNA endonuclease 
involved in intron mobility. Cell 83:529-538. 

Zinnen, S., and M. Yarus. 1995. An RNA pocket for the planar aromatic side 
chains of phenylalanine and tryptophane. Nucleic Acids Symp Ser 33:148-151. 

Zoller, M. J., and M. Smith. 1984. Oligonucleotide-directed mutagenesis: a 
simple method using two oligonucleotide primers and a single-stranded DNA 
template. DNA 3:479-488. 

Zuidema, D., and E. M. J. Jaspars. 1984. Comparative investigations on the coat 
protein binding sites of the genomic RNAs of alfalfa mosaic virus and tobacco 
streak virus. Virology 135:43-52. 



BIOGRAPHICAL SKETCH 

Hymavathi K. Tirupati obtained her undergraduate degree in agriculture in 
1987 from the Andhra Pradesh Agricultural University, India, followed by a 
master's degree in genetics and plant breeding in 1989 from the Indian 
Agricultural Research Institute, India. After two years of graduate studies in 
molecular genetics, she entered the graduate program in molecular genetics and 
microbiology at the University of Florida in 1992. She joined the laboratory of Dr. 
Alfred S. Lewin for her graduate research in 1993. 



149 



I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and 
quality, as a dissertation for the degree of Doctor of Philosophy 

/ 




1 




Alfred S/Lewin, Chair 
Professor of Molecular Genetics 
and Microbiology 



I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and 
quality, as a dissertation for the degree of Doctor of Philosophy 




imes B. Flanegan 
Professor of Molecular 
and Microbiology 




I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and 
quality, as a dissertation for the degree of Doctor of Philosophy 



A^~ 



t'. /l^— 



Henry V. Baker 

Associate Professor of Molecular 
Genetics and Microbiology 



I certify that I have read this study and that in my opinion it conforms to 
acceptable standards of scholarly presentation and is fully adequate, in scope and 
quality, as a dissertation for the degree of Doctor of Philosophy. 



b 




Philip J. Laipi 

Professor of Biochemistry 

and Molecular Biology 



This dissertation was submitted to the Graduate Faculty of the College of 
Medicine and to the Graduate School and was accepted as partial fulfillment of the 
requirements for the degree of Doctor of Philosophy. 



December, 1998 



Dean, College of Medicine 



Dean, Graduate School 






UNIVERSITY OF FLORIDA 



3 1262 08555 3013